HA tagging a DNA construct - Need a protocol for HA tags (Jan/08/2009 )

Hello All,

Does anyone have a protocol for adding a HA tag onto a DNA construct that will then be inserted to a vector?

Thanks

The easiest would be to design primers. Assuming you want to put the HA tag on the NT of your gene, the forward needs to include the restriction site of choice for cloning, the entire HA sequence along with a little of your specific gene (10-20 bases should suffice). This is going to be a very long primer! You also want to delete the ATG from your gene of interest so start the gene specific portion of the forward primer with the second amino acid and be sure to put the ATG before the HA tag so that translation occurs properly. Don't forget to think about a kozac sequence if you are going to express in mammalian cells. You then do a PCR with this forward, a gene specific reverse (with a digestion site for cloning into the vector), and the cDNA with your gene of interest as the template. You may need to do what is called a ramp-up PCR whereby the annealing temp is raised after about 5 cycles. This is because, at first, the only part of the primer that will anneal to the template is the gene specific portion and this requires a lower annealing temp but as you begin to get product which has the HA containing primer and this becomes template, you don't need such a low annealing since the entire primer will now anneal. You may also need to do a "nested" PCR. If you get really low yield in your first pcr, you purify what you can and then use the purified product as the template for a new pcr. This should give you much better yield.

Here is an example of a forward primer I designed and used to put an HA tag onto a gene:

AGCTCGGATCCACCATGTACCCATACGATCGGCCACATTACGCTGCCAAGCATCTCATCACTCTG
overhang-BamHI start ------------HA tag--------------------- gene specific

You must include an overhang so your restriction digest will work, some enzymes require more or less. Check the NEB catalog (cleavage close to the end of dna fragments) for whatever enzyme you are using and what it requires.