Troubleshooting help for PCR - No amplicon: 500bp (Oct/16/2008 )
hi 
   i am trying to amplify a specific fragment of 500bp from genomic DNA coupled with restriction site of BspMI.
primer1:     CACCTGATGCAGGTTGAACTTGTTCATTTT 
                  
                  GC: 40%        Tm: 65.5 c
primer 2:     GCATAATTGCAGGTAAGACTATCCCATTTCTCCA
                  
                  GC: 41.2%      Tm: 67.4 c
the bold and underlined are mismatches & not complimentary to the template (required for the restriction enzyme). i tried different pcr protocols including gradient and touchdown, but no amplicon was obtained. 
reaction mixture: 25ul
taq buffer(incl. of MgCl2): 3ul, taq: 0.5ul, dNTP: 0.5ul, gDNA: 3ul, primers: 1ul each, H2O: 16ul
please help me out with this problem. 
 
thanx in advance.  
 
  
probzy
Fisrt!
which is the annealling t?
which are  the concentration of Mg, DNtps??
I such a basic protocol
94 3min
94 1min
 50 30s
72 1min
35 cycles
72 6 min
If the the fragment is GC rich you could put DMSO 2% or 4%.
The annealing is i bit low but afterwards you can change it.
Good luck!!
Tell me  the results!!
I forgot!! you must do the reaction in 50ul to minimize the interferences.
Check the sequence of the primers, 
Mg 2.5mM, dntp's 10 mM 0.5ul, 25p/mol from each primer, ADNg 150-200ng.
thanx capu for the reply.
i usually use 1-1.5mM mgcl2 (reaction conc.), and i tried out different annealing temps for a 25ul setup.
however, yesterday, i ran another reaction with little excess of enzyme and dNTPs and a different touchdown pcr.
i started off with an annealing temp of 64.5 c (below the Tm of both the oligos) and thereby -0.5c per cycle for 15 cycles and the rest 16 cycles at an annealing temp of 55 c for a time of 50s to 90s.
i got an amplicon from this but the band was very feeble n faint.
troubleshoot pls. 
 
  
thanx 
 
 
probzy