Expression Vector sequencing problem - (Jul/08/2008 )

I have a very strange problem.
I have solved most of my problems thanks to Protocols Online. I was one of those people who had a hard time with cloning. But after my 22nd ligation, I have 3 positive clones! I was happy into sending them for sequencing and the sequence is as I want it and is in frame.
I went up happily to tell my supervisor when she told asked me to check the vector itself.
I am using the pQE30 expression vector and am using SphI and HindIII as my cloning site.
The Met and 6x His Tag is fine but at the beginning of the sequence there is a 13 nucleotide frameshift. Is this normal? Can I still use my positive clone for expression work? Or do I need to purchase a new stock of pQE30. Or is it the sequencing problem?

My methods in a dash : -
Stock was made by isolating from E.coli DH5alpha liquid 7ml culture using SV Minipreps and stored in ddsH2O.
I cut my 7ug of vector in 50uL cocktail with 30U of SphI and HindIII overnight.
Purify with Qiagens Gel Extraction kit eluting in 15uL ddsH2O.
Ligate 10uL cocktail overnight with 100U of T4 DNA ligase by NEB.
Plate on LB-Amp and use LB-Amp broth for screening with RE and PCR.
I purify my samples with SV minipreps (Promega, USA) and send about 15uL (80ng/uL) with 50pmol of the PQE forward primer.

>clone
TGGACTAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATAGATTCAATTGTGAGCGGATAACAATTTCACACAGA
ATTCATTAAAGAGAAGAAATTNACTATGAGAGGATCGCATCACCATCACCATCACGGATCCGCATGC

>pQE30

CTCGAGAAAT CATAAAAAAT TTATTTGCTT TGTGAGCGGA TAACAATTAT AATAGATTCAATTGTGAGCG GATAACAATT TCACACAGAA TTCATTAAAG AGGAGAAATT AACTATGAGAGGATCGCATC ACCATCACCA TCACGGATCC GCATGCGAGC TCGGTACCCC

I badly need help. Thank you.

---

Hey!
- From the sequences that you provided I don't see any frame shift. The >clone seems to be just a part of the >pQE sequence
- Frame shifts could be only one or two base pairs. Do you mean 13 bp deletion?
- Looking at the way the MCS is build in pQE30 I would say that cloning into SphI site was not a best idea: SphI has an ATG in it, so the cell transcription apparatus will be confused trying to produce one protein that starts with Met right before the His tag, and another protein that starts at SphI. Whichever you are trying to make, the expression will be low.
Anyways, if you provide some details about first two points, may be we could figure things out
Andriy

---

Hi Andriy,
Thanks for your reply.
Yeah I meant the 13 nucleotide deletion. I checked my previous chromatograms and they showed inconclusive peaks. My supervisor told me not to worry and ignore it.
So I will be proceeding with my expression work to test your theory. I didn't realise the ATG on SphI before. Truly I didn't. The insert sequence is a codon optimised sequence that was previously constructed by my supervisor. I will ask her tomorrow in regards to that. I do know though, that the SphI seq in itself are amino acids in the expected recombinant protein.
I am still rather fresh to hands on Molecular Biology but the expression would still be there right? Considering that the sequence is as so, can you recommend steps for me to improve the amount of expression? I will be slowing down the expression (by lowering IPTG most probably, and perhaps temperature, and maybe increasing Amp concentration) because I suspect that most of my protein will end up being insoluble due to hi Cys residues in the protein.

---

oh and so forgetful of me, I can't use BamHI as well because it is found on my insert sequence

---

Well, if remaking the construct would be such a pain, try expressing your protein first.
Run SDS-PAGE with uninduced/induced lanes right away.
And if you can't see any expression, don't waste time on optimizations with the IPTG and the temperature.
Fix the problem a the root :-)

---

Hi Andriy,

I have just tried expressing the protein and ran SDS-PAGE. We don't really have a proper photodocumentation system in our lab so once my mounted gel is dried, I can post it up.
Thing is, my protein of interest is about 18kDa and the 6x His tag will only be about 0.3kDa right? So I should look in the vicinity a band below 20kDa.
I seem to see an intense band but in my control the said band is also there. My control is M15 with pQE30 transformed in it.
Perhaps as you have mentioned, the hypothesized low expression level =(

I will post up the photo as soon as I can. I will try to redo the expression tomorrow just to see whether it is really the contructs problem or my skills and this time I will use 0.5mM instead of 1mM IPTG for induction based on this http://www.protocol-online.org/biology-for...osts/11521.html
My sequence is codon optimized for E.coli expression

I performed expression in JM109 and M15 cells along with controls of the cells that have pQE30 transformed in them. JM109 shows no expression of the above intense band whatsoever. Hence, I deduced that that is my expressed protein. But what I am doubting myself on this is because of the intensity of the band which may just be part of the cellular protein.
I have normalised the cellular density of each consequtive samples taken to that of T=0hr. I took up to T=3hr. But with our old clone of the same gene the intensity is pretty high even upon normalising the samples.

We have cloned this synthetic gene before into pGex-4T-1 but the expressed protein is insoluble but the expression was high and intense. Hence, we have decided to clone the gene intopQE30 where the purification can be carried out under denaturing conditions.

---

As promised the gel photos. Sorry as I couldn't load them one by one but had to zip them down in a folder.

As highlighted in green are p11, highlighted in red are p14 and yellow or c(0) or c(3) are controls.
Those with [] brackets are 1mL fractions.

All cultures were induced expression at OD600nm = 0.7.
Cultures were grown at 250rpm, 37 degrees Celcius.
I first tried with 1mM IPTG and then repeated it again by lowering the IPTG level to 0.5mM thinking there would be some changes but the profiles seem similar.

---