Flag sequence - yeah I know, stupid question :D (Feb/04/2008 )

So here I come,

I want to have the DNA sequence of the Flag_tag. I have the aminoacid sequence but was looking for the DNA.
Now I know with the aminoacid I can find the Dna, but I know some "codon" are more represented than others... so I wanted to know if anyone has it.

If not then yes, I'll just choose the proper DNA sequence.

Thanks all.

I imagine you could google it in the sequence of any pFLAG expression vector... Should definitely be OK.

gactacaaggatgacgatgacaaa

this is how we have it in one of our vectors ...