H3K9me2 and H3K27me3 positive controls - (Mar/17/2009 )

Hi everyone,


I'm performing ChIP experiments on Tera-1 cells (human embryonic carcinoma cell line) followed by Real time-PCR. I found reliable positive controls for active histone modifications (H3K4me2, H3Ac,...) but didn't find good positive control genes for the repressive marks H3K9me2 and H3K27me3. Does anyone have an experience in control genes for those modifications in hEC/hES cells ?

Thanks a lot

Hey there

We are not using hEC/hES cells but found Gsx2 a good control for H3K27me3 in human AML cells (and 'normal controls'). It's involved in brain development or something. You could give it a go? The primers:

forward: CCCGGAAACCGAGGGATAGA
reverse: GGCCGAGTGTTGCCCTCTAA

Hope this helps

Clare

Xenos on Mar 17 2009, 02:19 PM said:

Clare on Mar 17 2009, 06:23 PM said:

Hey there

We are not using hEC/hES cells but found Gsx2 a good control for H3K27me3 in human AML cells (and 'normal controls'). It's involved in brain development or something. You could give it a go? The primers:

forward: CCCGGAAACCGAGGGATAGA
reverse: GGCCGAGTGTTGCCCTCTAA

Hope this helps

Clare

Xenos on Mar 17 2009, 02:19 PM said:

Hi everyone,


I'm performing ChIP experiments on Tera-1 cells (human embryonic carcinoma cell line) followed by Real time-PCR. I found reliable positive controls for active histone modifications (H3K4me2, H3Ac,...) but didn't find good positive control genes for the repressive marks H3K9me2 and H3K27me3. Does anyone have an experience in control genes for those modifications in hEC/hES cells ?

Thanks a lot

Let us know how you get on

Clare