PCR HELP!!!! - (Feb/17/2013 )

Hi I was trying to amplify a 5kb fragment from genomic DNA using Phusion high fidelity PCR but I never got any success. my forward primer is CCCACGAAACTCAAAATGTGTTCAGATTGC and my reverse primer is CACGAGCCAAAGTCATGCCAAAGAC. When I calculated the tm using the Tm calculator from Finnzymes it showed me around 72 C for both. I did a 2 step PCR with 72C but was unsuccessful. Each time I get a very low molecular band of around 200bp. I extracted the DNA and again ran the PCR but it was a failure again. I did a gradient with tm 55 to 65 which gave the same result. I used new dNTPs and borrowed enzyme from a collegue and saw that I had the same result. All my parameters look fine like primer concentration etc. Any suggestions? Please HELP.

BLAST your primers against the genomic DNA and see what you get.

Your primers are big - standard PCR primers are 18-22 bp long. If you have added sites so that you can clone off the product - these bases should not be included in the Tm calculation.

Have you played with the Mg2+ concentration?