What should I do in front of a McGill University Professor who does not care abo - (Apr/29/2015 )
I have a paper reading course in McGill University for PhD students.
A Professor is in charge of this course. I usualy find a msitake in primers in paper in average one out of 15 papers, so that these primers do not bind to that gene of interest in paper and so that data is fake.
But this professor laughed at me and siad in front of students: Haha ha he (me) likes primers.
Actualy this is not the first one. Also I found that he does not know what primer is and what it is for. and how to check primer.
What should I do? After 30 years from invention of primer?
First of all, I think it's awesome that you check the primers for consistency. Well done.
Now, about your situation, first be absolutely sure that the primers really won't bind to the target. Sometimes, for various reasons, the designed primers have a few mismatches. In this case the primer would bind anyways (and sometimes with better performance, or with specificity for an allele...). These mismatched primers might, perhaps, not show up in a default BLAST search (depending on your parameters) - they will surely not be found by a literal search. Also, sometimes primers were designed from a sequence that wasn't perfect and that doesn't match the official human genome - this isn't so rare in old papers.
So I would first check the literature (i.e. Google Scholar) for other occurrences of the same primer sequence (not a guarantee of correctness, but it's a good sign); then check whether the primer really binds somewhere else, or whether it has a few mismatches; and if it's mismatched, consider if it could extend anyways. If the differences are in favor of it not binding, then yes it might well be a typo... sometimes it happens. It doesn't have to be necessarily fake data.
when you do Primer-Blast for a primer from a 13 impact factor journal in 2014.
And these primers bind everything except the gene of interest, you say again this:
"sometimes it happens. It doesn't have to be necessarily fake data.."
I'm not sure if you are supposed to find fake papers or what, but true is many times there, the primers are wrong or have a mismatch not mentioned (mismatch can be tolerated in old papers, but not in new).
I think truth is, people just plainly don't care much about correct sequence and use primers that "their grandma used " (haha) and never check them later cause they "work", or they mistakenly switch the sequences for other primers, or for a reason of keeping them secret they intentionally don't publish the right ones, because this is so common that you can always say it was a mistake.
This of course is not true in "methodic" paper, since everyone will try it and find it doesn't work.. but in common papers.. primes, who cares..
My boss says, the better impact the less they care about what details of PCR you state, if you are putting it into lesser impact they will want to know exactly the sequences and conditions, if you were to publish in Nature? No one cares..
So mistakes are common and even if it's sometimes intentional probably, it doesn't mean the data are fake. But it is wrong to do so. Without primer sequence you cannot check for potential problems thay the study may not have addressed (like... later will be found, that these primers bind nonspecifically... it is important to include this right).
But I suppose it is considered a minor problem, faka data on the other hand is a serious scientific misconduct.
do you have some examples of papers with mistakes? I am curious to see.
But yes: it happens.
Ok this is a sample from Nature:
http://www.nature.com/nature/journal/vaop/ncurrent/abs/nature13684.html#supplementary-information
Primers are in this link:
Supplementary Table 10. Primer sequences
http://www.nature.com/nature/journal/vaop/ncurrent/extref/nature13684-s2.zip
Just check the B2m for mice and CXCL2.
B2m does not bind at all.
https://i.imgur.com/bDsRUJu.jpg
https://i.imgur.com/t9qGkHl.jpg
https://i.imgur.com/Mu3qRtc.jpg
Babak
The reverse primer AGCTATCTAGGATATTTCCAATTTTTGAA indeed lacks a T to match the official sequence (which is AGCTATCTAGGATATTTCCAATTTTTTGAA).
Still, it matches the alternate Celera assembly. And I think it would extend. I can see a couple of other papers that used the same reverse primer (and curiously, no papers that used the "reference" sequence). I think they just bought the same primer that they saw published, and I can see how it can extend after all.
Check: try BLASTing this,
ATGCACGCAGAAAGAAATAGCAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AGCTATCTAGGATATTTCCAATTTTTGAA
Algorithm: blastn, expect: 1000, word size: 7.
I find:
http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&VIEW_RESULTS=FromRes&RID=MFND3WSB01R
You can see a good match for the Celera genome and a partial match for the refseq genome, but extend it a bit and you'll see that the problem is one T.
r.rosati on Mon May 4 20:36:28 2015 said:
The reverse primer AGCTATCTAGGATATTTCCAATTTTTGAA indeed lacks a T to match the official sequence (which is AGCTATCTAGGATATTTCCAATTTTTTGAA).
Still, it matches the alternate Celera assembly. And I think it would extend. I can see a couple of other papers that used the same reverse primer (and curiously, no papers that used the "reference" sequence). I think they just bought the same primer that they saw published, and I can see how it can extend after all.
Check: try BLASTing this,
ATGCACGCAGAAAGAAATAGCAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AGCTATCTAGGATATTTCCAATTTTTGAA
Algorithm: blastn, expect: 1000, word size: 7.
I find:
http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&VIEW_RESULTS=FromRes&RID=MFND3WSB01R
You can see a good match for the Celera genome and a partial match for the refseq genome, but extend it a bit and you'll see that the problem is one T.
Indeed, got the same blasting the reverse primer: https://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_144227219
However I find it weird they do not refer to what sequence they used.
If you check one of the sequences/references they make, you end up with another sequence than this one.
They should be better in mentioning what exactly they used. It is sometimes frustrating to figure these things out yourself.
Another funny papers that all primers are wrong except one:
Impact factor 6 and Cited by 188 since 2009 until now:
http://atvb.ahajournals.org/content/29/6/936.full
this paper should have been in retractionwatch.com
Pretty funny indeed.
Only 1 primer (the reverse, second primer in the supplement) is indeed correct.
BMF on Fri Feb 12 01:34:24 2016 said:
Another funny papers that all primers are wrong except one:
Impact factor 6 and Cited by 188 since 2009 until now:
http://atvb.ahajournals.org/content/29/6/936.full
this paper should have been in retractionwatch.com