Dimers and weird bands after Bis-PCR - (Sep/29/2005 )

I recently ran a quite confusing matrix of PCR reactions with 15 different primers for bisulfite PCR. I designed them myself, so I'm not sure if the failure was due to my primers, or some other factor. I used a nested, gradient PCR with 45 cycles, and ended up with what look to be dimers in some rows, and then 200-300 bp products in other rows (which is not the expected size). I need help deciding if my primers are properly designed, since that seems to be the major trip-up.

Thanks

how are your primers selected?

could you post one example for us all to look at?

Cheers

Nick

I chose the primers by selecting 18-30mers that lay outside the region of interest and contained no CpG dinucleotides. To amplify the top strand of DNA, I deisgned the 5' primer as identical to the bottom strand of sequence, with all G's replaced by A's. The 3' primer is the top strand of sequence, reversed, and with all C's replaced by T's.

For example, if the DNA sequence is:

ATGCATGGGATTACTCACATTTAAGGC,

then the 5'primer (just a 15-mer for example) would be:

TACATACCCTAATAA

and the 3' primer would be:

TGGAATTTATATTTA

I designed about 15 primers this way, then checked their Tms and secondary structure with Vector NTI, and they all seemed acceptable by those standards. Am I completely wrong in my design? If so, can you suggest another strategy, because I'd rather design them myself than use a program.

Thanks again

Buckie, you are on the right track, and it's a very good attitude to take, picking primers yourself and not relying on a computer program to do it.

the 3' ends of you primers end how? To ensure you are directly amplifying templates that are fully converted you should pick your primers in a way that the 3' ends have many conversion events.

ie: if the sequence was

AATCGCCCTTAACCCTTAA

you should aim to have the 3' end of your primer end in the bold and underlined characters

this will help to alleviate your problem.

Good luck

Nick

I'm trying to design the primers by eye, but every oligo I try forms dimers with itself. It seems that this is almost impossible to avoid, with the sequence being so A-T rich. What is the cut-off energy for dimer strength? Will a touchdown PCR reduce the risk of primer dimers?

Thanks so much

Try Sigma JumpStart Red Taq if you have not use it, you may solve the dimer problem and say a huge difference.