wrong sized bands/smear in both nested MSP PCRs - (Jun/29/2005 )

Hey!

I am really distressed! My MSP just won’t work. I ran a nested PCR. But already the first universal PCR didn’t give me a clear band - it was more a big smear with a faint band of the wrong size (~280 instead of ~320 bp).

I used this universal RXN as template for the next MSP/USP PCRs anyway, but wouldn’t get my small product (119 bp)

I already tried two different methods: gDNA isolation using the Dneasy Tissue Kit from Qiagen and bisulfite conversion of 2µg gDNA with the EZ DNA Methylation Kit from Zymo Research.

In the other approach I used the Puregene DNA isolation Kit from Gentra. For the bisulfite treatment I followed the protocol from Paulin et al, which uses urea to improve the efficiancy of the conversion (or is supposed to). I used the QiaexII Kit to clean up the DNA.

As far as the gDNA is concerned: I checked the integrity with an Alu-PCR and my gDNA seems fine (although I am not sure if this PCR isn’t too insensitive to detect differences in the amount of gDNA – I used 5 ng as template)

I also used the Platinum Taq from Invitrogen to improve the specificity of my PCR. But I still only get a smear/no bands.

Can anyone give any advice where I can improve my PCRs, how to check integrity of the converted gDNA or if any of the kits I used suck?

Also, I attached the sequence I am interested in with the primers I designed. Maybe some of you can see an obvious error in the primer design?!

Any help would be MUCH appreciated!!!

Thanks, Hazel

Hi Hazel,

I am wondering what were the Tm conditions for each PCR round?

I calculated your primer Tm for the universals as being 59 and 56 for both forward and reverse respectively the MSPs 66 and 69 respectively.

Are your USP primers the same as your MSPs but with the terminating C's as T's?

If you are getting smears it may be worth your while to increase the Tm within your PCRs.

Good luck!

Hi Hazel,

The primer design seems fine to me.

Can you give us your PCR conditions such as number of cycles?

After first PCR (up to 40 cycles) you may not be able to see a clear band or smear. Just go ahead with the nested PCR using 1-2 ul of first PCR product as template and cycle 25-30 more cycles.

Try Sigma's JumpStart RedTaq.

I am concerned about using QiaexII Kit for DNA clanup after modification.

Have you tried other primers? For each gene you should have at least two sets of primers just in case one doesn't work.

Hey methylnick and pcrman!

Thanks for your replies!

First thing I saw is that my annealing temps differ quite a bit from the temps you calculated. I always went with the Tm's I got from IDT DNA (that's where I order my primers from)

Ok, here are my PCR conditions for the Universal PCR:

94°C - 5'
94°C - 1'
46°C - 1'
72°C - 1'
72°C - 5'

I ran the PCR for 35 cycles. I chose the low annealing temp, because of the IDT-given Tm's of 51°C (Fwd) and 48.9°C (Rev) - and I always thought that you should stay a couple °C below the lowest Tm !?!

My MSP conditions are the following:

94°C - 2'
94°C - 30''
55°C - 30''
72°C - 1'
72°C - 5'

I also ran 35 cycles for this PCR using 2µl of the universal PCR as template in a 25µl RXN. Tm's for the primers (again IDT):
Fwd = 57.8°C
Rev = 60.8°C

My USP primers are exactly the same as the ones for MSP, except for the unmethylated and therefore altered C:

USP-Fwd: TGTTAGATTTTATTTTGTTTTATTGTGTTTTGTTTT (Tm = 54°C)
USP-Rev: AATACCTCTACAACTCTACACCAAAACAAACA (Tm = 58°C)

The conditions for this PCR are the same ones as the Universal, with an annealing temp of 51°C.

So, besides the temp-differences: do you think I should increase my number of cycles? And which "conversion-approach" would you suggest? Should I go with the EZ-kit? I actually would have to reorder the EZ-kit - is there maybe a better one which you would recommend?
Or do you preferr the other method (Paulin et al.)? If so, which other kit or method would you advise for the DNA clean-up, if you are concerned with the Qiagen kit?

Oh, and yeah: I tried another set of primers (Universal, MSP, USP) but wouldn't even get a smear, but only primer clouds...


Thanks so much for helping me!!!

Hazel

The Tm for your universal step seems awefully low.

if you are routinely getting smears from your primer sets I would suggest you increase the Tm of your universal step at least to 52C.

There are all sorts of ways for calculating Tm with many variations of Tm calculations under the sun. Some take into account salt concentrations and some don't so you should be a little be wary of this.

For a bisulfite Kit, i reccommend methyleasy from here it's a pretty easy kit to use.

I have not had any experience with QiaexII DNA extraction kit so I can not comment of that, but you must...MUST have clean genomic DNA to start with.

But the problem with you getting non specific amplification and smears suggests that your PCR conditions need to be optimised. So I would start on that first.

good luck

Nick

I ordered primers form IDT but i never used their Tms, they usually gave you lower Tms then other companies for the same primers. Very low! The difference some times was 8c, you cannot believe it. Don't use their tm as PCR annealing temp.....