human IgA1 sequence - (Apr/18/2005 )

Hello everybody,

I'm looking for the DNA sequence of the alpha2 and alpha3 domain of the human IgA1.
Although I surved pubmed / blastsearch for several hours, I'm not able to find an DNA sequence matching the primersequences

TCAGTAGCAGGTGCCGTCC

and

AAAGCTCTCCCAGCTCCTATCGA.

As I have to find out exactely which part of the IgA was cloned with these primers, I would be really happy if someone could give me a hint how I can improve my searching efficiency.

Thanks in advance

Nadja

have a look at

http://www.ncbi.nlm.nih.gov/entrez/viewer....de&val=49257463

it's

"homo sapiens immunoglobulin heavy constant alpha 1, mRNA"

containing one of your sequences (TCAGTAGCAGGTGCCGTCC).

The other one (AAAGCTCTCCCAGCTCCTATCGA) seems to pose a problem, there were no Ig hits when blasted.... so maybe you want to check your primer sequence for that one, you know sometimes things get mixed up, and you end up with one human and one mouse primer

mike