PCR does not work - what is the problem? (Dec/30/2004 )

I am trying to get PCR product from a plasmid.
The forward primer: (AAAAAAAACATATG)CAGCGGGCGCGACCCACGCTCTGG:
Backward primer: (AAAAAAAAGGATCCCTA)CTTGCTCTGCATGCTGTAGC
The sequence in () is the part I want to insert to the PCR product and are not surpose to bind to the template. I tried anealing temperature 55 and 64 degree and I also tried different amount DNA template (1ng to 200ng). But I got no band.

could anybody tell me what may be the problem?

Thank you.

Hi, chen,I guess the problem due to your forward primer! Too many G and C may let it not work.

Agree with Paul. The forward primer has a unusual high GC content. So the difference in Tm of the two primers is very big.

Double check your primer sequence to be sure there is no errors. Also check if your template DNA is good.