Primer dimers!? HELP - (Dec/17/2008 )
Hello...
I am trying to amplify a 2.0 kb PCR-product to be used in homologue recombination.
My target is a Km cassette cloned in PBSK. I use special primers of about 70 nts, but only 20 nts align with my target (the other 50 nts are the homology regions I am adding to the sequence).
I've been doing this with different cassetes and primers with no problem, but this time when I made the PCR, I got a very faint band of my desired 2.0 kb product, and a very intense and defined band of a little less than 200 bp. Is this band some primer duplex???
I tried purifying the 2.0 kb band from the gel and reamplificating, but I still have the 200 bs band, and my 2.0 kb band has completely gone!!!
Any help????
This is the information I have from the PCR-simulation with Vector NTI for the reamplification -->
Tm: 80.1 C TaOpt: 61.7 C GC: 50.2
Sense Primer: LDM36F
TCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAATCTGCAAACCCTATGCTACTCCGTCG
Similarity: 100.0%
Length: 76 Tm: 74.8 C GC: 57.9
dH: -615.6 kcal/mol dS: -1543.4 cal/mol dG: -153.7 kcal/mol
Antisense Primer: LDM31R
AATAAAAAAGCCCTGGCAGTTACCAGGGCTTGATTACTTTGAGCTAATTATCCCGGCGGATTTGTCCTAC
Similarity: 100.0%
Length: 70 Tm: 68.4 C GC: 44.3
dH: -581.3 kcal/mol dS: -1492.0 cal/mol dG: -134.7 kcal/mol
Tm Difference: 6.3
GC Difference: 13.6
why are you current PCR conditions?
My PCR conditions are:
10 cycles:
94º -->30s
61.7º -->1min
72º -->2 min
20 cycles.
94º -->30s
61.7º -->1min
72º -->2 min +5s (each cycle)
I'm using HighFidelityExpansion Kit
I would use different PCR conditions with these primers:
1. Decrease the annealing time during the first rounds of PCR. 20s should be more than sufficient. Longer annealing times increase the likelihood of non-specific amplification, so I always try to keep them short.
2. I would do an initial 5, not 10 rounds of annealing at 61.7 (which I would assume is a few degrees below the Tms of the regions of the primers that are complementary to the template). These are necessary to generate several copies of full-length PCR products that will then serve as templates in subsequent rounds pf PCR.
3. I would do the remaining 25 cycles going back and forth between 94° and 72°. There is no need to anneal at 61.7, because now the full-length primers will be annealing to the templates, and their Tms are above 72 to begin with. This will also decrease the likelihood of non-specific amplification.
So the PCR I set up would look like this:
5 cycles:
94º -->30s
61.7º -->1min
72º -->2 min
25cycles.
94º -->30s
72º -->2 min +5s (each cycle)
Ginger
The principal problem is that your annealing temp is to low for the primers. The Tm's of the primers are 74.8C and 68.4 C so the annealing temp should be around 71C (the promedy of both annealing). Too low temp will give unspecified products. Also for a so big product you can denature for more time (at least 45s) to give time enough to the threads to open correctly so the primers can anneal.
But remember that only 20 bp of the primers are complementary to Neko's target DNA, and you have to use the Tm of only these complementary regions during the first few rounds of PCR. Also, you don't use the average Tm of primer pairs: generally you use the lower one as a guide. If you have two Tms, one 55° and one 75°, and use 65° for annealing, the primer with a Tm of 55° will never be able to bind because the temperature will always be too high.
Ginger
Hi Neko,
could you high light the section of your primer that actually binds to your DNA template?
Primer LDM36F
TCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAATCTGCA AA CCC TAT GCT ACT CCG TCG
Primer LDM31R
AATAAAAAAGCCCTGGCAGTTACCAGGGCTTGATTACTTTGAGCTAATTA TC CCG GCG GAT TTG TCC TAC
If I assume the section in bold actually bind to the template, I get an estimated tm of
LDM36F = 60 C
LDM31R = 63 C
The tm you are using is too high. Reduce the tm to at around 58 Celsius. I believe this is the main problem.
As for the PCR cycle
94º -->15s
58º -->20s
72º -->2 min
25 cycles
72º -->5 min
since your template is a plasmid, you don't need a long melting time, 10 sec is actually good enough. But I'll leave it at 15 sec. Template annealing time is abit long. 20 sec is okay since your template is plasmid DNA.
That should be enough. I have not been able to locate the HighFidelityExpansion Kit on the web. What kind of polymerase does this thing use? I assume it is some kind of proof reading polymerase.
perneseblue: I misspelled the name of the kit.... the right name is Expand high fidelity PCR system from Roche, it is indeed a proof reading polymerase.
----------
Thanks everyone for your good suggestions!! I'm going to try several PCR conditions and tell you what happened! 
Try PCRboost. Its a product I found from a company called Biomatrica. It really helped me out!
Austin