MSP primer does not work - (Dec/16/2008 )
I have another set of MSP primer which does not work. I design them from methprimer. please help me to check it! the following is details
By the way, when using methyprimer, which number do you often set for 3' CpG constraint? If is it easier for PCR to use 3 or 2 than 1?
Thank you very much.
submitted sequence
GTTCCAAAAGCTAGCCTGGGTCCCACGTCATCTTGCACATCTGGGCCACCCAGATCAGCTAGGCTCCCGCCGGTGAACTC
AGAACTAGTCCAGACGGATGGCCCTCTGTCCCGTGAGCACTGGACCCCAGGGCAGGCCTGCTACGGGGATCCTGGGCTTGA
CTTCCCGCTTTCTCAATCTCCGAGCTCCGGACCCGCGCGGAGCTAGGACTGACCAAGCGCGCTCCTTCTGTCCCCGGCCGG
CGCTCCGATCAACTCGGCCCTCGGGTCAACCGCTCCTTTTTCTCCTTCCCCCACTTTTCCTGTTTCGCGGGGGCCGGGGTG
GAGGCGGAGAAGGAGGCGAGGAGGCAGCGGAGAAGGGGGCAGCCGGGAGGGGGGAGGGGACCGGAGAAGGAGGCGACGCGG
GGCGGGGAAAGAGGAAGAGCCGGGGATGCTCGCGCTTAAAACCGAAAATAAACAACGTCCTCGGGCTGCGGCCTCGTGTCT
GCCCGACCGCGCGGGGGCCTGGCCGGGACACACTTACCGGTCCGCCGCGGCGTGCAGGCCCTGGTCCCGGGTACACGCAGC
GGCTCTTCTCTGCGCGCTGTTCCCAACCGGAGGAGCGCAGCGTACCGCTAAGGGTTCAAAACGCCCGCGCGCGTCCTGATT
GGCGGGCCGGCCCATGGCTGGCCTCGCCGATCTTCCTATTTTCTTCTTTTTATAGATGGACTCGGAGCAAGGGAAACCTCG
CCGAGGGGCGTCAGGCATAGACGAAAGTTTCGGGACCCGAAAGTTAACCGGAGCGAAAGCCGATCGGCGCAGGAGACGTTG
CCGGCCGGCTGCGAAAGGGCGCAGCTACTGCTAGGGGGCGGGCGGTGCGCACGCGTCCCGCGGCGCTGGCTGTCACCGCGA
TGGGTGGCGAGCGAAGCGAGCGGGATCCGGAGCGTGCCCTGCGCGGGAGGCAGCGGGACCCCGGATGCGGCAGGGCCCGCG
CGCGCCTCCCCCTGGGCGCCTCTGGGAAGCTTTCCCGCGCGACTGGGGACCGCGCGCCTTGGGACTCGGGGGCGCGCCTGA
GGGCGGAGATGGGCGTGGAGCAAAGATGGGCCGGGGGCGGCGCGTGGGTCTCGAGGTGCCTCAACGCCGAAGGGGCTGGGG
GCGGCGCTTCTCACCTCGCTTGTCACAGTGAGGCCGCCGCTGAGGGAGTACAGCAGCGGGAGCATGGGTCGCAGGTTCTTG
GTCACTGTGAGGATTCAGCGCGCGGGCCGCCCACTCCAAGAGAGGGTTTTCTTGGTGAAGTTCGTGCGATCCCGGAGACCC
AGGACAGCGAGCTGCGCTCTGGCTTTCGTGAACATGTTGTTGAGGCTAGAGAGGATCTTGAGAAGAGGGCCGCACCGGAAT
CCTGGACCAGGTAGGAAAGGCCCTCCGAAGCTGCACGCACAGGTGCCGTGGCTCCGCGTGCTTCTGTGCATCCGCCCCACG
AGGTAGAAGCAGGACGGGCCCCGGTGGGGACTTCAGGTGGGGGAGGGGAGGGGTCGCTTTCCCCCTTCGGCTTAGTTCCCG
GGAGATGGAGTACTTTGCACACGGTGAGGCTGAAGGGGTCGGCTTCACGGTCCTCCTCAACCCTGCAAAAAAGGAGAAAAA
AAGGGGGGAAAAAAAGAAAAAAAAAAAAGCCTAAG
primer (set 3' CpG constraint for 1)
methylation F: AAAATAAATAACGTTTTCGGGTTGC
methylation R: TTTAAACCCTTAACGATACGCTACG
unmeth F: AAAATAAATAATGTTTTTGGGTTGT
unmeth R: TTTAAACCCTTAACAATACACTACA
PCR conditions would be very helpful, especially annealing temperatures. Do you run PCRs with both primer-sets at the same temperature? I'm asking because checking your primers with 'Primer Premier' I found the whole set of unwanted side-effects like hairpins, stable dimers and cross-dimers and a high difference of the calculated annealing temperature between the methylated and unmethylated primer-sets. That's why I personally don't like these primer-designer programs. The only positive aspect is the location and the number of covered CpGs which should make both PCRs highly specific for their corresponding methylation status.
If possible reduce the annealing temperature by shorten the primers and pay attention that both primers have the same melting temperature. Running your PCR with approximately 5 degC above the calculated annealing temperaure would make your PCR more specific. Btw: what kind of DNA and which amount have you used?
Hope that helps...
MoB
I use mouse genomic DNA. and I do gradient PCR(55-65) to decide the condition. but there is no any accordant band.
which enzyme do you use? common one or platinum taq?
what is mg2+ centration in your buffer? I often use 2mM or 2.5mM, is that low?
which enzyme do you use? common one or platinum taq?
what is mg2+ centration in your buffer? I often use 2mM or 2.5mM, is that low?
In my opinion 65°C is too low. Differences regarding melting temperature between sense- and anti-sense primer are > 5°C. I'm absolutely sure that this causes your PCR failure. I'm affraid, but for me it seems you have to re-design your primers. I never allow a software to design my primers. My criteria are:
- primer-length: 20 - 27 bp
melting temperature: ~52 - 54°C
cross-dimers, primer-dimer: < -8 kcal/mol
annealing temperature: 5-8°C above the highest primer melting temperature
I always check my primers with 'Primer Premier 5.0' for hairpins, dimers, cross-dimers, Tm, etc... Even probes for MethyLight. It's worth a try...
For my MSP/BSP-PCRs I use standard HotStart Taq (Qiagen), MgCl2-concentrations are similar, primer (depending on the PCR) are 0.2 µM up to 0.5 µM final concentration. I always run 40 cycles.
Thank you very much, It is cherished experience. I still have several problem?
primer (depending on the PCR) are 0.2 µM up to 0.5 µM final concentration, what this mean? I often use 0.2uM as the final concentration. would you think somtimes this concentration does not work?
in addition, I am afraid my tutor does not want me to order the new ones in the short time. do you think I can try this set of primer for high temperature? what temp is expected?
When you order primer, do you use desalting purification or others? for MSP primer, how you store to avoid them degrading. I think my primer has degraded. I use stock concentration for 100nm in the water. I often think this system is not stable, espeically for MSP primer. How do you think that?
Do you met the situation that one set of primers work well just 2 days ago, but they can not work aften 4-5 cycles freezing and thawing?
Thank you very much.
which enzyme do you use? common one or platinum taq?
what is mg2+ centration in your buffer? I often use 2mM or 2.5mM, is that low?
In my opinion 65°C is too low. Differences regarding melting temperature between sense- and anti-sense primer are > 5°C. I'm absolutely sure that this causes your PCR failure. I'm affraid, but for me it seems you have to re-design your primers. I never allow a software to design my primers. My criteria are:
- primer-length: 20 - 27 bp
melting temperature: ~52 - 54°C
cross-dimers, primer-dimer: < -8 kcal/mol
annealing temperature: 5-8°C above the highest primer melting temperature
I always check my primers with 'Primer Premier 5.0' for hairpins, dimers, cross-dimers, Tm, etc... Even probes for MethyLight. It's worth a try...
For my MSP/BSP-PCRs I use standard HotStart Taq (Qiagen), MgCl2-concentrations are similar, primer (depending on the PCR) are 0.2 µM up to 0.5 µM final concentration. I always run 40 cycles.
primer (depending on the PCR) are 0.2 µM up to 0.5 µM final concentration, what this mean? I often use 0.2uM as the final concentration. would you think somtimes this concentration does not work?
in addition, I am afraid my tutor does not want me to order the new ones in the short time. do you think I can try this set of primer for high temperature? what temp is expected?
When you order primer, do you use desalting purification or others? for MSP primer, how you store to avoid them degrading. I think my primer has degraded. I use stock concentration for 100nm in the water. I often think this system is not stable, espeically for MSP primer. How do you think that?
Do you met the situation that one set of primers work well just 2 days ago, but they can not work aften 4-5 cycles freezing and thawing?
I always start with 0.5 µM primer concentration when testing a new designed PCR and reduce concentration if dimers appears on the gel. If I don't get a specific amplificate with this concentration I re-design the primers.
In my project primers have to be reconstituted in water to 100 µM stock concentration, aliquoted and stored at -20°C. Working solutions (10 - 30µM) have to be prepared prior to the PCR, these solutions have to be also stored at -20° and must to be discarded after 3 cycles of thawing/freezing. Degradation occurs but also strongly depends on the primers' sequence. I found primers containing G-stretches to be more sensitive against thawing/freezing than other primers.
For BSP/MSP PCR I always order the smallest synthesis-scale for which (for most distributors) only the standard purification is possible. HPLC- or PAGE is not necessary, I think.
I would increase the primer concentration and run a gradient from 65 to 70°C. If this won't help, I would start re-designing primers... But to be honest: I doubt it...
Btw: which template DNA do you use? Are you certain about the methylation-status of your DNA? Have you used a fully methylated mouse DNA? I'm asking because if your DNA is only partionally methylated and just by accident the status of the CpG at the 3' end doesn't match your primer, the PCR performance will go down dramatically.
Hope that helps...