deisgning primers with restriction site - (Nov/18/2008 )

Hi,

I'm designing primers with Xho I restriction enzyme. I'm new to this and would appreciate any assistance.

The start of my gene is at 112bp and the stop codon is at 786bp. I had initially designed primers with the restriction enzme site immediately upstream of teh start codon but the sense and anti sense primers have tm of 80deg and 60deg respecively. I've tried PCR at 60 and 70 deg BUT no results. Thus, have to design new primers.

Can I have primers lets say starting at 19bp instead of immediately upstream of the start codon? i.e. aaaa-restrction enzyme site-primer sequence.

A pstdoc in lab said that adding the sequences upstream of thr start codon sometimes affects the post translational modification and affect the protein?

Also, the tm for primers with the restriction enzyme site is obviously different from primers w/o the restriction site. So, which tm shoud i bee looking at.

---

Before ordering new primers, I'd run PCR once more at a lower annealing temperature (at least for the first few cycles). The annealing temperature during the first few cycles of PCR should be about 2° lower than that of the priming site of your 60° primer (i.e. the Tm of the part of primer that is complementary to the template, and not including and extra bases and your restriction site.) This is crucial because during the first few rounds of PCR the primers need to efficiently anneal to your template DNA. After 5 cycles, increase the annealing temperature to account for the Tm of the entire primer including the restriction site.

Also, why are you using one restriction site and not two different ones? Half of your clones will be ligated backwards, and you will have a much higher chance of getting empty clones.

Another question: how long are the regions of your primer that are complementary to your template, and what are the Tms and GC content of these regions? You should always design a good primer first (good length, Tm, GC content) and then add the restriction site and extra bases afterwards.

Finally, you can always increase the Tm of your lower Tm primer by making it a few bases longer. Contrary to what you hear, you can normally get away with having an A or T at the 3' end, so long as the GC content is okay and reasonably distributed throughout the primer.

Ginger

---

thank you for your response.

I'm adding different restriction sites to the sense and antisense primers. The problem is that the antisense primer only has a gc content of 15% b/c the sequence is such. The primers are 20bp long. so my question is: I had designed primers from 786 to 767 bp but the gc content is too low i.e. 15%gc and teh tm is 37deg.

e.g. the stop codon si at 786bp.

721 agccaattga ccagcaatcg gcagcatgct cgattaagag tatgccaaaa aatagaaaag
781 ctataaatat ttcaaaataa agaagaatcc acattgcaaa aaaaaaaaaa aaaaa end of gene squence.

Can I design primers from: 799bp-821bp. aaagaagaatcc acattgcaaa. this gives me 30%GC and tm=48.


My concern is that is primer is 12b down stream of teh stop codon. IS that alright? So, I will put the kpnI restriction site to this:

gaga-kpnI restriction site-primer length

---

Firstly, 15% is wayyyyyyyy to low a GC content, and you should always avoid repetitive stretches in primers.

Can you post the entire gene sequence you want to amplify here plus the sequences directly upstream and downstream, and highlight the start and stop codons ? I'll try and find a few minutes today to figure out priming sites. (I know it sounds strange, but primer design and cloning is my favourite thing to do!)

Ginger

---

hi,

You're help is truly apreciated! Cloning is not my favourite!
gene sequence: ATG (112bp) and stop codon (786bp) in bold

1 cagacgacgt gctgagctgc cagcttagtg gaagctctgc tctgggtgga gagcagcctc
61 gctttggtga cgcacagtgc tgggaccctc caggagcccc gggattgaag [/color]gatg[color="#FF0000"]gtggcg
121 gccgtcctgc tggggctgag ctggctctgc tctcccctgg gagctctggt cctggacttc
181 aacaacatca ggagctctgc tgacctgcat ggggcccgga agggctcaca gtgcctgtct
241 gacacggact gcaataccag aaagttctgc ctccagcccc gcgatgagaa gccgttctgt
301 gctacatgtc gtgggttgcg gaggaggtgc cagcgagatg ccatgtgctg ccctgggaca
361 ctctgtgtga acgatgtttg tactacgatg gaagatgcaa ccccaatatt agaaaggcag
421 cttgatgagc aagatggcac acatgcagaa ggaacaactg ggcacccagt ccaggaaaac
481 caacccaaaa ggaagccaag tattaagaaa tcacaaggca ggaagggaca agagggagaa
541 agttgtctga gaacttttga ctgtggccct ggactttgct gtgctcgtca tttttggacg
601 aaaatttgta agccagtcct tttggaggga caggtctgct ccagaagagg gcataaagac
661 actgctcaag ctccagaaat cttccagcgt tgcgactgtg gccctggact actgtgtcga
721 agccaattga ccagcaatcg gcagcatgct cgattaagag tatgccaaaa aatagaaaag
781 ctataaatat ttcaaaataa agaagaatcc acattgcaaa aaaaaaaaaa aaaaa

I want to amplify the whole coding sequence to clone into pcdna vector for expression studies. My only concern is that if i have primer staring upstream (underlined) or down stream(underlined) of teh ATG or stop codon, will that affect my protein? Also, need to ensure the kozak sequence is there for efficicnt translation. The ozak seq of this gene is in red.

I'm need to add XhoI restriction site in the sense and KpnI site in the antisense primer.

Thank you

---

the coding seq is from 112-786bp.

---

try to play with different primers at
www.justbio.com
alos used software like electronic PCR.
used one blunt and one overhand restriction site.
I will look at the sequence later....

---

I have designed teh following primers but the reverse primer is a bit ticky since teh end of teh gene is rich i T's and A's

F: gggattgaaggatggtggcg
Tm=56
%GC=60%

F: ATTGAAGGATGGTGGCGG
Tm=50
%GC=56

R: TTTGCAATGTGGATTCTTC (reverse complimentary 818-802)
Tm=42
%GC=41

The reverse primer does not start immediately upstearm of the stop site (stop codon i.e. 786.), is that alright? Will it affect my protein outcome?

Thanks

---