who can give me a hand to check the BSP primer? - (Mar/23/2008 )
hi,
everyone
i am a newer here, and i know little about the methylation. I want to try to learn more through time is not enough. i will graduated in June.my supervisor ask me to check the methylation of glucocorticoid receptor gene.
i have some troubles to design the BSP primer. i use the Methyl Primer Express v1.0 to design.
i selet two primers,can you help to check them?
the gene ID: NM_001008481
i use the segment from 1 to 383. i think the segment is the 5'UTR.
attttgcgag ctcgagtctg tgacgggagc ccgagtcacc gcccgcccgt cggggacggg ttctcgtggg tggaaggagc cgccgcggct ggagcggctg gagcggcggg gcgccggcag cgaggacgcg cgcccgggag ccccggccgg cggagcgggg cggggggccg gcttgtcagc ggggaaatgg gggactttct tcgctagggg ccctcccctc cccccatgga gaagggggcg gctgtttact tccttttttt ttaagaaaaa aaaaatcgct cccgctcctc ctgctttcac acgctaagtt gtttatctcg gctgcggtgg gagccgcgga cggcggcggt gagcggcgcc gcgggcagag ctgataccca ctg
primer1:
FORWARD(25,43)
Length: 19bp.
5' GGGAGTTYGAGTTATYGTT 3'
Tm=58.27; CpG=2; C=6
REVERSE(249,275)
Length: 27 bp.
5' TTTTTTTTTTCTTAAAAAAAAAAAAAA 3'
Tm=58.79; CpG=0; C=3
PCR PRODUCT Length: 251 bp.
primer2:
FORWARD(220,238)
Length:19 bp.
5' TTTTTTATGGAGAAGGGGG 3'
Tm=60.26; CpG=0; C=6
REVERSE(358,377)
Length:20 bp.
5' ATATCAACTCTACCCRCRAC 3' Tm=60.58; CpG=2; C=4
PCR PRODUCT Length: 158 bp.
the rules I followed:
1,Primers should not contain CpG sites within their sequence to ensure unbiased amplification of both methylated or unmethylated DNA.
2,Primers should have an adequate number of no-CpG 'C's in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's will be preferred.
3,If CpG island prediction is not used for primer selection (default), PCR products must span a minimum number of CpG sites specified by the user (default: 5).
the two primers both contain CpG sites, the CpG sites were replaced by Y or R, can them work well?
the reverse primer of the first pair has so many T or A,can it work?
thanks very much!
Hi
your primers won't work well.
1st pair is absolutely not acceptable, lower primer will form a loop and a self dimer and i don't think there's even as hint of chance you will get any product
primers of the 2nd pair form a 3' dimer that should be avoided.
dear gangut,
thanks very much for your reply!
i tried,and have found the third pairs
Forward: 5'GTTTGTGACGGGAGTTCGAGT3' （5'GTTTGTGAYGGGAGTTYGAGT3'）
Reverse: 5'CAATAAATATCAACTCTACCCGC3' (5'CAATAAATATCAACTCTACCCRC3')
the third pair also has dimer,cross dimer and false priming. i am sorry,i can not avoided them.
can you help me to design one in your free time?
the sequence:
attttgcgag ctcgagtctg tgacgggagc ccgagtcacc gcccgcccgt cggggacggg ttctcgtggg tggaaggagc cgccgcggct ggagcggctg gagcggcggg gcgccggcag cgaggacgcg cgcccgggag ccccggccgg cggagcgggg cggggggccg gcttgtcagc ggggaaatgg gggactttct tcgctagggg ccctcccctc cccccatgga gaagggggcg gctgtttact tccttttttt ttaagaaaaa aaaaatcgct cccgctcctc ctgctttcac acgctaagtt gtttatctcg gctgcggtgg gagccgcgga cggcggcggt gagcggcgcc gcgggcagag ctgataccca ctg
Dear Loopliu,
I'll try to do my best but could you pls give me a sequence +/- 300 bp upstream and downstream of this fragment?
hi gangut,
thank you! you are so kind.
i will contact you later.
best regards.
loopliu
hi gangut,
i am sorry reply so late.
i am afraid that i can not get +/-300bp of the sequence i am interested. may be little is konwn about it yet.
the sequence i attached above is the 1 to 383 bp of the mRNA ID: NM_001008481.
your reply to youryuer "How come it is unknown? If you blast your sequence with human genomic and get the coordinates, can't you extend the region of interest using for ex. map viewer by NCBI (click download sequence region)."may make sense.
and methynick have already helped me do that you have said.
methynick write to me"Firstly, it's not a good idea to pick primers from a cDNA/mRNA sequence as they can be inaccurate, you need to pick the gDNA sequence. I have blatted your sequence against the human genome, I am assuming it's a human sequence." see the accessories.
you mean the same with methynick? he is also a good guy.haha
thank u!
loopliu
the whole sequence of the NM_001008481
1 attttgcgag ctcgagtctg tgacgggagc ccgagtcacc gcccgcccgt cggggacggg
61 ttctcgtggg tggaaggagc cgccgcggct ggagcggctg gagcggcggg gcgccggcag
121 cgaggacgcg cgcccgggag ccccggccgg cggagcgggg cggggggccg gcttgtcagc
181 ggggaaatgg gggactttct tcgctagggg ccctcccctc cccccatgga gaagggggcg
241 gctgtttact tccttttttt ttaagaaaaa aaaaatcgct cccgctcctc ctgctttcac
301 acgctaagtt gtttatctcg gctgcggtgg gagccgcgga cggcggcggt gagcggcgcc
361 gcgggcagag ctgataccca ctgatggacc ccaaggaatc gctgaccccc cccagcagag
421 aagaaatccc cagcagcgtg cttggccggg agagagccca tgtgatggac ttctataaaa
481 gcctgagggg aggaactcct gtgaaggttt ctgcagcttc accctccctg gctgctgtgt
541 ctcagccaga ctccaagcag cagaggcttg cggtggactt tccaaaaggc tcaggaagca
601 atgcacagca gccagatctg tccaaggcag tttcactctc catgggactg tacatgggag
661 agaccgaaac taaagtgatg ggaagtgacc tgggattccc acagcagggc caaatcagcc
721 tttcctctgg ggagacagac ttccggcttc tggaagaaag catcgcaaac ctcagtaggt
781 cgaccagtgt tccagagaac cccaagagtt cagcctccgc tgctggtcct gctgctccgg
841 cagagaaggc gtttccaaaa acccactctg atggggctcc agagcagccg aatgtgaagg
901 gtcagactgg caccaacggg ggtaacgtga agttgtttac cacagaccaa agcacctttg
961 acatttggag gaagaaactc caggatttgg agcttccttc tgggtctcca ggtaaagaga
1021 caagtgagag tccctggagc tcggacctct tgatcgatga aaactgtttg ctctcccctt
1081 tggcaggaga ggaggatccc ttcctcttgg aaggaagctc gaccgaggac tgtaagcctc
1141 ttgttttgcc ggacacgaaa cctaaagtga aggataacgg agagcttatc ttaccgagcc
1201 ccaacagtgt gccactgccc caagtgaaaa cagaaaaaga agattttatc gaactctgca
1261 ccccaggggt gattaagcag gagaaactgg gcccagccta ctgtcaggcg agcttttctg
1321 gggcaaacat aattggtggt aaaatgtctg ccatttctgt tcacggggtg agcacctcgg
1381 ggggacagct gtaccactat gacatgaaca cggcagcatc cctttccaaa cagcaggagc
1441 agaaacctct ttttaatgtc attcccccga ttcctgtggg ttcagaaaat tggaatagat
1501 gccaaggatc tggagacgat aacttgactt ccttggggac tttgaacttc tctggccgat
1561 cagttttttc gaatggctac tcaagccctg gaatgagacc ggacgtaagt tctcctccat
1621 cgagctcctc agcagcaacg ggaccacctc ccaaactctg ccttgtgtgt tctgatgaag
1681 cttcgggatg tcattatggg gtcctgactt gtggaagctg taaagtattc ttcaaaagag
1741 cagtggaagg acagcacaat tatctttgtg ctggaagaaa tgactgtatc attgataaaa
1801 ttcgaagaaa aaactgtcca gcatgccgct acagaaagtg tcttcaagct ggaatgaacc
1861 tggaagctcg aaaaacaaag aaaaagataa aaggaattca gcaggccact acaggagtct
1921 cacaagaaac ttctgaaaat tctgctaata aaacaatagt tcctgcaacg ctaccacagc
1981 tcacccccac cctggtgtca ctgctggaag tcattgaacc cgaggtgttg tatgcaggat
2041 atgacagctc gattccagat tccacctggc ggatcatgac cgcactcaac atgttaggcg
2101 ggcggcaggt gattgcagca gtgaaatggg caaaggcaat accaggattc aggaacttac
2161 acctggatga ccaaatgacc ctcctgcagt attcatggat gtttctcatg gtgttcgccc
2221 tggggtggag atcatacaga caatcaagtg ccagcttgct gtgttttgct cctgatctgg
2281 ttattaatga gcagagaatg gctttaccct gcatgtatga ccaatgtaga catatgctgt
2341 atgtttcctc tgagttacag aggcttcagg tgtcttacga agagtatctc tgtatgaaaa
2401 ccttactgct tctctcttca gttcccaagg acggtttgaa gagtcaagag ctatttgatg
2461 aaattagaat gacctacatc aaagagctag gaaaagccat tgtcaagagg gaaggaaact
2521 ccagtcagaa ctggcaacgc ttttatcaac tgacaaaact cttggactcc atgcatgatg
2581 tggttgaaaa tctccttaac tattgcttcc agacattttt ggataagacc atgagtattg
2641 aattcccaga gatgttagct gaaatcatca ctaatcagtt accaaaatac tcaagtggaa
2701 atatcaaaaa acttctgttt catcaaaagt gactgcctta ataagaaagt ttgccttaaa
2761 gaaagctgaa tttatagctt ttattgtaca agctatcaat ctgtcctgta gcggttttct
2821 tatttttttt ccctttttgt ttttgtctgg ttttttgttt tgaatacgca ctacatgtgg
2881 tttatagagg gccaagactt ggcaacagaa cagttgagcc atcactttcc agtgatggga
2941 aaaggagaaa gtgataggtg gtgaatccca aaaatgagaa ataataactt gggggcaagc
3001 tccactgtca gagaggatgg cacctaaacc accagtgccc gaagtttgtg tgacagactt
3061 tctgctcata cttttcacgg ttggacaaaa ttttctagac tttcgttggt gtattttccc
3121 ccatatagtt aggacagcat tttttgattt atgcatggat acctgaaaaa cgtttacaag
3181 tgtatatcag aaaagggaag ttgtgccttt tatagctatt actgtctggt tttaacagtt
3241 tcctttatat ttagtgaact acgcttgct