MethPrimer has wrong output (CG%) ? - CONCERNING THE METHPRIMER MSP-PRIMER FIND SERVICE (Feb/17/2008 )

CONCERNING THE METHPRIMER MSP-PRIMER FIND SERVICE

Hi there,

if you use the example sequence in MethPrimer, you get several possible primers, of course. But if you have a look at the data given with the primers, you'll find out, that for example the primer:

1 Left M primer 449 26 58.79 61.54 5 GGTTGGGTAATATAGGGAGATATAGC

the GC% of 61.54 does not fit the primer ?! There are 11 Cs,Gs in there, and this is not 61 %. The explanation is perhaps, that this is the %age of that of the non-converted primer. But is that reasonable?

I ask that, because primer3, which is said to be the base of MethPrimer, gives the actual percentage of the primer. It would say, the above primer has CG% of 42%.

Perhaps one can explain that..?

Thank you!!

---

I think you have anserwed your own question there!

You can also try ABI's MethylPrimer Express which is also free.

Nick

---