Searching Sequences in NCBI Databases - (Jul/31/2007 )
Hello everyone,
I have a really basic question and I hope to get answers from the veterans of you soon - in which direction are the sequences listed in the NBCI database (5' - 3' OR 3' - 5')? I am using Entrez Nucleotides and I want to construct a probe for in situ hybridisation, but I am totally confused about the direction of the sequences. There must also be a difference if I need a probe directed against mRNA compared to genomic DNA - but I am not sure how to do this. I have the same problem with the design of primers for PCR - when do I have to use the complementary inverted sequence (reverse primer???) and when just the sequence which is published in the databases? In the help-section I could only find details for the searches e.g. BLAST, but there is no handbook about the common features of genbank etc.
Weird greetings 
,
Barbara
With very few exceptions, sequences are nearly always listed in 5' to 3' order (including specifying orders for primers).
About the only time this is not true is if both strands are shown with complementary matching, like this:
5' GAATTC 3'
3' CTTAAG 5'
where the bottom strand is written in reverse orientation to match up with the upper strand.
This is different from the issue of what direction the genes are oriented, or what direction the mRNA is sequence is oriented in on a piece of DNA. Genes may be oriented in either direction.
For PCR, primers are always extended at the 3' end, so the forward primer should be a copy of the initial part of DNA sequence you want to clone, while the reverse primer should be the reverse complement of the final part of the DNA sequence you want to clone.
5' gctagctagcacac 3'
5' actgctagctagctagcacactacgtggactaccagtttcagctacgtacacacacttt 3'
3' gtcgatgcatgtgt 5'
The two primers producing the product are:
5' gctagctagcacac 3' and
5' tgtgtacgtagctg 3'
These primers would be ordered in this form.
Thank you very much, phage434!!! Do you know a web page etc. in which the general common features of the NBCI databases are summarized?
Greetings from Vienna, Barbara 
Greetings from Vienna, Barbara
Have you checked the Tutorials?