MSP Primer design -rules to choose primers and reasons - (May/23/2007 )

Hi below are the primers we have used in the MSP protocol for the BRCA1 gene

Forward:

Actual CCGTGGCAACGGAAAAGCGC 20
Methylated TCGTGGTAACGGAAAAGCGC 20
Unmethylated TTGTGGTAATGGAAAAGTGT 20

Reverse:


Actual AAGTCTCAGCGAGCTCACGCCG 22
Methylated AAATCTCAACGAACTCACGCCG 22
Unmethylated AAATCTCAACAAACTCACACCA 22

In the above example,. most of the primers used in MSP for methylated reactions are not matching the human genome sequence (human genome 18) at C's (at Gs in reverse primer).

How do you explain these mismatches? These mismatches are usually there for all sequences.

Also are there any rules for designing MSP primers? If there are, can anyone tell me the reasons behind those rules?

Hi Anthoceros,

In order to research methylation of a dna template, it must first be bisulfite modified. This is the simplest way to be able to distinguish methylated Cs from non-methylated Cs.
During bisulfite modification all non-methylated Cs are transformed to Uracil which is later transformed to T during PCR. Only methlyated Cs will remain C. Therefore, the only place you might get to see a C in a modified template is in front of a G (this is because only such Cs standing in front of Gs can be targeted by the DNMTs, the enzymes responsible for methlyation).
So the original genomic sequence won't help you with MSP primer design. You must always modify it to reflect to bisulfite treatment. You will have less Cs than expected in your forward primer and less Gs than expected in your reverse primer.

As for MSP primer design, I believe there are some nice pinned topics concerning it, you should look for posts by Methylnick, PCRMan and Krümelmonster

cheers

Hi Anthoceros,

In order to research methylation of a dna template, it must first be bisulfite modified. This is the simplest way to be able to distinguish methylated Cs from non-methylated Cs.
During bisulfite modification all non-methylated Cs are transformed to Uracil which is later transformed to T during PCR. Only methlyated Cs will remain C. Therefore, the only place you might get to see a C in a modified template is in front of a G (this is because only such Cs standing in front of Gs can be targeted by the DNMTs, the enzymes responsible for methlyation).
So the original genomic sequence won't help you with MSP primer design. You must always modify it to reflect to bisulfite treatment. You will have less Cs than expected in your forward primer and less Gs than expected in your reverse primer.

As for MSP primer design, I believe there are some nice pinned topics concerning it, you should look for posts by Methylnick, PCRMan and Krümelmonster

cheers