Bisulfite: PCR condition or primer problem? - (May/03/2007 )

Hi there, I still have difficulties with my BS treatment... no w I have positive results in some cases.
- If I'm running a PCR with the bisulfite treated genomic DNA from the MethylEasy (I'll refer to it as ME) kit with ME primers, it works well.
- If I'm using the non-treated genomic DNA from the kit, and I do the BS modification, and then I PCR it with oit's primers, it works - so I suppose my BS protocol is ok. (My mouse genomic DNA was modificates in the same way in the same time, paralelly, and the mouse primers did not amplify)
- I was testing my genomic DNA (from mouse, not from the kit): just run a normal PCR with beta-actin primers - it works, so I think my gDNA is not so much degraded
- I was running a PCR on the kit-supplied gDNA (it is human) with the primers I'm using (they are mouse, but the genes I examine are highly conservated), I didn't get any product. In the same time I used the same DNA with the supplied primers as a positive control - it was ok.
- But when I was running the PCR on my BS treated template with the ME primers, I got the right sized band.

so I just would like to know, in your opinion, it is looks like the primers are not ok, or can be any other reason for my unsuccesfullness? now I have extremely long amplification time (2 minutes at the beginning, later 1 minute; the amplicon size is about 500-600 basepairs), and for last attempt, I annealed the primers at 50 degrees. (with the commercial primers with unknown sequence 54 degrees was pretty low enough to have nice amplicons). In fact, now I saw a very poor smear somewhere near to the size I was expected the product - but I'm not sure if it is a contamination or not.

If anyone has any idea... pls help.
J.

---

Just a short question - do you do a nested approach? I allmost allways need to do it...

---

I have a question regarding nested: How large are your designs? During BS modification lots of strand ruptures occur, so I'm a bit scared to use a nested approach as it usually requires larger amplicons. Any wisdom for me?
If you could add some general advice on nested setup basics (I need it for BSP), that would also be extremely helpful as I really don't have a clue

---

primer design sounds like your issue.

post your primers and target sequence for us to have a look at.

for a nested approach, I usually perform heminested. The firs set amplifies up to 1.5kbp while the hemi-nested primer will then amplify between 500-800bp.

Nick

---

Yes, it is a nested PCR

---

Hi Nick,

Sorry for taking so much time, I was away for a couple of days. Primer design most surely is my issue

Here goes:

Target (BS corrected)
GTGAAAGGTTTTTGGATGTTTATGATTTTTATTAATAATTTTTTTTATGAGGTAAAGAAAGTTGATTATTTAAGATATAA
TAGATGTTTTAGGGGTTGGTGATGATGGTGGTATATGAAGAAAAATATATATTTTTAATAATATAATAGTAAATAGAATTT
AGTAATATATTAAAAAGGATAATATATTATGATTAAGTAGTATTTATATTATAGAAGTAAAATTGGTTTGGTATTTAAAAG
TTAATTAATTATATTTGTATTGAGGTTATTATAGTTGAGAAGATATCGTTTTTGTGGTTTTAGTTTTTGGTTGTAGGTCGT
TGATGGAGGTTTAGAAGGTTAGTTGTTTATAGATATTAATTTGGTGTCGGTTGCGGTTTTAGTATTTTTCGTAGGTTGTAGTTTTTGGGTTTTAAATTTTTTATTTTTTAGTTTGTAAGCGGGTTAGTTTCGAATAGGAAGTAATTTTTTTTTTAGTCGGGAGGTGGCGGTTTGCGGTCGACGATGTTT
TCGGGGTTTTTGGGTTTAAGGTTTCGTTTGGGGGCGTTTTCGTTCGGTTTGCGGGTCGTTTTTTTTTATAGACGGAATTTT
TTGGTGGCGTCGTTGGTTTTTGCGGGGTTTGTAAACGGCGCGTATCGGGTTTTTTTCGTTTTTCGTATAGGTTTTTGTTGTTGGTTGGGTTCGGGAGGGAACGTTTTAGGTAAAGCGTTGGGGGAGGAA

Sequencing Primer Forward
GTTTTTGGGTTTTAAATTTTTTATTTTTTA + M13

Sequencing Primer Reverse
CAACCAACAACAAAAACCTATAC + M13



I'm afraid the target sequence I pasted omits part of the reverse primer. I will try to find the remaining sequence in ensembl ***done and updated***; it should be somewhere upstream close to exon 1, right? (In case you're wondering how I can't be sure of that, please remember that I was just recently pushed into this position of responsibility I designed none of this myself, I only took it over from my predecessor)

The M13 tail is quite long, the primers are incredibly large, Tm of 70°C. However, I was using a Tm of 55°C, because the complementary strand for the M13 tail had to be synthesized in a first step (much like you pointed out for the rest of BSP in the other thread) and therefore the actual Tm of the first cycles should be lower, because only part of the primer will be able to bind. Is that correct?

And I am very impressed by the size of your amplicons! I would have never thought such huge amplicons to be possible with BDNA! I thought BS modification induced so many strand ruptures... You also use Qiagen Epitect, right? Is there a trick or have I just been listening to the wrong people?

I have optimized my MSP conditions (dNTP, Mg, and primer concentration) and have been using this setup for BSP. Should I reoptimize for the different primers and PCR program?
Questions, questions, questions... I really appreciate your help, without this forum, I'd be absolutely done for!

---

I fired up the old MPE and designed a new heminested pair, any thoughts welcome:

Target:
GGTTGGTGATGATGGTGGTATATGAAGAAAAATATATATTTTTAATAATATAATAGTAAATAGAATTTAGTAATATATTA
AAAAGGATAATATATTATGATTAAGTAGTATTTATATTATAGAAGTAAAATTGGTTTGGTATTTAAAAGTTAATTAATTAT
ATTTGTATTGAGGTTATTATAGTTGAGAAGATATCGTTTTTGTGGTTTTAGTTTTTGGTTGTAGGTCGTTGATGGAGGTTTAGAAGGTTAGTTGTTTATAGATATTAATTTGGTGTCGGTTGCGGTTTTAGTATTTTTCGTAGGTTGTAGTTTTTGGGTTTTAAATTTT
TTATTTTTTAGTTTGTAAGCGGGTTAGTTTCGAATAGGAAGTAATTTTTTTTTTAGTCGGGAGGTGGCGGTTTGCGGTCGA
CGATGTTTTCGGGGTTTTTGGGTTTAAGGTTTCGTTTGGGGGCGTTTTCGTTCGGTTTGCGGGTCGTTTTTTTTTATAGAC
GGAATTTTTTGGTGGCGTCGTTGGTTTTTGCGGGGTTTGTAAACGGCGCGTATCGGGTTTTTTTCGTTTTTCGTATAGGTTTTTGTTGTTGGTTGGGTTCGGGAGGGAACGTTTTAGGTAAAGCGTTGGGGGAGGAAGCGACGTCGAGGAGTTACGGTTTTTTTTAGAGGTTTTCGT
TTTTTTGTTTTTATATTTTTAGAGTTCGAGTTTGATTCGGGTTTTGTCGGGTATTTTGGAAAGGCGGGGG

HemiOutsideForward:
Length: 27bp.
5' TTGAGGTTATTATAGTTGAGAAGATAT 3'
Tm=56.02; CpG=0; C=5

HemiInsideForward:
Length: 22bp.
5' GTTGATGGAGGTTTAGAAGGTT 3'
Tm=59.77; CpG=0; C=4

HemiReverse:
Length: 19 bp.
5' CCCAACCAACAACAAAAAC 3'
Tm=60.42; CpG=0; C=4
(-> 5' - 3' complementary sequence: GTTTTTGTTGTTGGTTGGG)


HemiOutside Amplicon size: 421 BP

Final Target Amplicon size: 361 BP

---

hi cyburn,

I am not too sure the reverse primer is ideal, I usally have them end in an A or a string of A's because you really want them to end in a conversion event (ie: a T that was a C prior to conversion, or in the opposing strand, the reverse primer an A that was a G prior to conversion).

The hemi reverse seems a little short and of low complexity only consisting of two bases, they should also contain a couple of T's as well. (30mers is what I aim for)...this is why I don't like using programs to pick my primers for me!!!

As for the tailed primers, you strategy is correct, set the Tm for the sequence specific part of the primer (as if M13 sequence wasn't there.

Such amplicons are possible, and I haven't used the epitect kit, a PhD student has in the lab and loves it, I have either used homebrew bisulfite if I have plently of DNA to spare or methyleasy kit if I only have less than 200ng of DNA to start with.

MSP conditions would be different to BSP because you are using different primer sequences. So with BSP I usually start with setting the Tm 2C below the calculated. If that doesn't work, drop it again by 2C and i usually get amplicons coming up. If not, I use a little more starting template, as a LAST resort, I would perform a magnesium titration, but i haven't done one of those for a long long time now.

Good luck!

Nick

---

Thanks a lot, Nick! I'll redesign the primers according to your advice and try them out.

---

cyburn,

be sure to take a look at this http://www.protocol-online.org/forums/inde...showtopic=23544

and the size can be upto about 900bp for the second round amplicon.

Ncik

---