Very resistand band in PCR - (Feb/08/2007 )

Hi!

I have a frustrating problem. I have designed alelle specific primers to genotype a SNP (two forward differing by one nucleotide and one reverse primer, sequence given below). But they are not-at-all specific, because I am getting a band of otherwise appropriate size (115bp) even when I increase annealing temp to 72°C. I recently used a sample of DNA that never worked with any other PCR I tried (probably a fragmented sample) - and !!bam!! that nasty band appeared again. Could this be a case o dimerisation or sth? Is there anything to do with these primers or should I really order new ones (that isnt my favourite option, really).
I introduced a mismatch in primers at position marked with ** to prevent looping etc. Could this be the problem?
Can anyone help me get rid of this? Touchdown PCR and 5% DMSO didnt help What is this!?

My primers:
5 AC*A*GTGGTCTGTTCCCTGGAC(G/A) 3 forward (22bp)
3 CCGAGAAGGAGTCGTTGCCATA 5 reverse (22bp)

Thak you very much for any response... Have a nice day.

Ales

[HI
Can i see a pic of ur gel? if so we can work it out. am also working on PCR based assays. if u feel u can send me the pic of ur gel. i can see what best could be done. U can send it to my id: shankarmadhan@yahoo.co.uk > do msg in subject box that u r from Bioforum or i may delete it.
Regards
madhan

That sounds a lot like primer dimers... two options: play with every control you have Mg2+, different taq, gradients for annealing and elongation, etc. OR if you don't want to try out for weeks, design new primers...

Krümel

I would suggest a redesign of the amplification strategy, using Tetra primer ARM PCR with the addition of double mismatch to further reduced nonspecificity. (one mismatch at the penultimate 3'base and a second near the 3' end.) The current strategy is known to have problems of non specificity.

Tetra primer ARM PCR example paper.

I can't find any free papers online about the double mismatch primers at the moment. I'll go look up for a hard copy at work tomorrow.

Hi!
Thank you very much for your very helpful suggestions.

perneseblue, your suggestion looks very interesting.
Do you have any experience using Tetra-primer ARMS PCR? I read the article that introduced this method (by Ye S, et al. in Nucleic Acids Res. 2001 Sep), but in my opinion their protocols produced a large amount of ghost and non-specific bands. Is this the case in all protocols using this method? They suggest using longer (28bp) primers to increase specifity, but these longer primers are very hard to design without producing any loops or primer dimerisations. I am thinking of preparing a multiplex PCR with these primers and ghost bands can become a problem in multiplex reactions.
Do you suggest me to design all primers with two mismatches or is one mismatch three nt's from 3' end enough to produce the necessary specifity?

madhan, i'll send you the image as soon as I get to the lab.

Does anyone use Bi-PASA PCR? Is this any good? It looks interesting too.

Thanks again!!
Ales

I have limited experience with Tetra-primer ARMS PCR. I introduced the idea to a labmate and helped designed the primers for single simple screen (wild type vs nucleotide correction mutant). The screen worked well enough. Although we did not attempt anything more complicated then the 4 primer mix.

All primers that bind to nucleotide polymorphism have a single base mismatch (strong/weak, moderate/moderate, weak/strong) at the 3rd nucleotide from the 3'end. The 3'end nucleotide (last basepair) is the base that can either base pair with the polymorphism or forms a mismatch. The correct primer has 1 mismatch while the wrong primer has 2 mismatches.

Never tried Bi-PASA PCR but it looks like an improvement on the Tetra-Primer ARMS PCR, only thing different from what my labmate and I did seems to be the incoperation of the GC rich region on the inner primers. Maybe addition of the GC rich region makes all the difference. ::ponders::

And finally thanks for introducing Bi-PASA PCR!

I read somewhere that those G/C tails cause increased preference of primers to bind to amplicons produced during the PCR and amplification from these amplicons is said to be more efficient than from DNA template.

Some time ago, I used a protocol with four primers: two sequence-specific forward primers (SSP, e.g. F1 and F2), a control forward primer that annealed upstream of the sequence specific primer and a common reverse primer. When I mixed one SSP primer (for example F1), the control and the reverse primer, the annealing of the SSP-F1 somehow prevented the upstream control forward primer from polymerising and in F1/F1 homozygotes no control amplification product was seen. In heterozygotes, both - control and specific products were seen.
Is this a bad case of my amnesia or only another variety of allele specific PCR(that would be really nice to try )?

Thank you!!

Have a nice day!
Ales

Hi!

I am sending you a photo of the gel where you can see the band I can not get rid of:
Image no. 1 shows my optimisation efforts for the multiplex I am trying to get to work (gradient PCR raising temps from 61,9-69°C).:
a- non-specific band was seen in every reaction that I tested (even after raising annealing temp to 69°C or so)
b- could this be a ghost band?
[attachment=2568:Picture1.jpg]

Image no. 2
a- the product is nonspecifically amplified with every DNA I use in my multiplex reaction
[attachment=2570:Picture2.jpg]

What to do to increase specifity of these primers? Can I increase the annealing temp to 72°C and more?



Image no.3
This image refers to my previous post. I mixed three primers and I could already define the genotype, only after performin one tube reaction with just three primers.
[attachment=2571:Picture4.jpg]

So, should I design primers in this way to get three-primer alelle specific PCR?
[attachment=2572:Picture5.jpg]

What do you think?

Thanks for any suggestions you can give!!
And have a nice day,
Ales