Qiagen EpiTect - Kit - No PCR product after BSP, only smear! (Dec/20/2006 )

Hey,
i´m a newbie in the field of epigenetics. I want to analyze the CpG-island of my gene of interest using BSP. I´m using Qiagen-EpiTect-Kit for conversion (i converted 2 ug and did not use the Carrier RNA), afterwards i do PCR using Primers designed by Methprimer and MethylPrimerExpress. Since i don´t want to do cloning, i plan to do a second round of PCR using tagged Primers, that hopefully allow direct sequencing . Unfortunately i don not get a PCR product after the first round of PCR. I only get smear. After some PCR-reactions i saw a faint product, but i was not able to reproduce it .

That´s why i´d like to know, if someone of you has any experience with this Kit and can give me some hints.

In how much elution buffer do you elute the converted DNA after the conversion procedure? I eluted in 20 ul.

How much converted DNA do you use in your PCR? I always used 1 ul.

Does it make sense to add DMSO to the PCR reaction?

I just ordered Qiagen Hot Star Taq. At the moment I am using NEB Taq Polymerase and ThermoPol buffer. Maybe i get better results using the new enzyme.

My PCR conditions are:

94°C for 2 minutes

40 cycles of 94 °C for 30s
annealing temperature = Tm of primer - 5 °C for 30s
72 °C for 1 minute
final extension: 72 °C for 7 minutes

I would appreciate your help!!!!!!

Thanks,
Mia

Hello Mia,

Congratulations that you have chosen the Qiagen kit for DNA modification which I think is the best of its kind. I guess your problem lies at the primer design or PCR. How long is your PCR product? Keep it below 400 bp, the longer the harder. I would reduce the time for each step because you are cycling 40 times, the enzyme would be boiled at 94C for 20 min! Typically I use the following conditions on a contemporary PCR machine: 94C-10", 56C-20", 72C-20", X40, a final extension for 5 min. for the frst round PCR. Hot start taq will certainly help.
If you start with 2 ug DNA, elute in 20 ul, using 1 ul for PCR (20ul reaction) sounds reasonable.

Hi Mia,

pcrman is certainly right with the question regarding the primers. Furthermore, I have noticed that PCR was more effective using H2O instead of elution buffer. I normally use 2-4µl of 30µl eluate as PCR template (with a hotstart taq, too).

But, most important - after thirty rounds of first round PCR I don't allways see porducts on the gel or only faintest bands - doesn't matter, anyhow, because after the second round (using tagged primers also) I have strong and clear bands at the desired positions, that can be directly sequenced. So maybe you just try to fly with eyes shut?

And, I have tested a lot of PCR conditions and found the protocol of Nick (pinned in the threads above, using very long annealing and extension intervals) to be gold. Two thumbs up. Even better, if you use slightly lower extension (CAVE not annealing) temperatures (65-68°).

And, as pcrman already mentioned, the Qiagen Kit is really good !

Much luck for your experiments!

Krümel

Thanks so much for your Replys!!!!!!!!!!! I´ll give your hints a try.

I designed my primers using MethPrimer and MethylPrimerExpress from ABI. My Amplicons are not larger than 400 bp. Is there any obvious mistake in Primer Design that might inhibit the PCR-reaction?


Primer Pair 1

Forward: GTTATTTATAATAATTTTTTAAAAGAATTAG

Reverse: ATAAAACTTTACAAAAAAACCCTAC


Primer Pair 2:

Forward: TTTGTAAAGTTTTATTAGTTTGAAGGA

Reverse: TTTGTAAAGTTTTATTAGTTTGAAGGA


Primer Pair 3:

Forward: GAGGTTTTTTTGTATTTTTTT

Reverse: AAACCCACCTACCTATCCCC


Primer Pait: 4:

Forward: GCGAGGTTAATGGGTTGGGT

Reverse: AACCCTCCTACAAACC


Primer Pair 5:

Forward: GGTTTGTAGGAGGGTT

Reverse: AAACCCACCTACCTATCCCC


Primer Pair 6:

Forward: TATGTTATTTATAATAATTTTTTAAAAGA

Reverse: TCCTTCAAACTAATAAAACTTTACAAA


Unfortunately i don´t have access to a gradient cycler. Thats why i have to test the annealing temperatures, which is very time consuming. I don´t which Tm calculator is the best, as there are so many and results are varying extremely. Which Calculator/method do you use?

Thanks again,
Mia

Hi Mia,

I normally use Netprimer to check my primers. In allmost all cases, 55°C for annealing works fine for me (I have the same problem - no gradients...).
Generally spoken, Methylprimer Express seems to produce good primers. There are some threads in this forum concerning primer design. Just flip around a little.
Some of your oligos i.m.o. have flaws like the very long T-stretch in 3F. Try to have some 3' converted non-CpG C->T to bias binding towards fully converted DNA. I have made the experience that longer oligos (>20bases) work better for bisulfite modified templates.
And you should definitely try a (hemi-)nested PCR, designing your tagged primers as second round PCR-primers within the first amplicon (I use Pimer3 for that purpose).

Best wishes,
Krümel

Hi Krumel,

I have tried to look for Nick's PCR protocol but could not find it easily. Could you please post this for me. I have been having a lot of problems getting a band after bisulfite treatment. Thank you in advance

Nael

Hi Nael,

I hope this link works!

http://www.protocol-online.org/forums/inde...?showtopic=4965

Krümel

I will post the protocol up on a pinned forum.

Nick

Hi,

i just wanted to let you know that the BSP now works fine. Using the Hot Star Taq from Qiagen was the best hint ever :-). After the first PCR round with untagged Primer i still don´t see any band, but after the second round i get the product i want. :-) So, finally i succeded. Sometimes research can be fun ;-).

Thank you all so much!
Mia

hello everybody,

I just have the same problem! Same kit, primers and conditions are wrapped from a paper. First try I got 6 certain products after nested PCR but since then i just amplify ghosts! I tried to change the primer and mastermix -aliquot, I tried with new aliquots of my probe and with several other probes but nothing, nada, niente, nix!
My PCR -conditions are (for first and second run):

4 min 95C

30 sec 95C
30 sec -3C/-5C of Primer Tm
2 min 72C
...35 Times

10 min 72C

My product is (or should be) ~ 630bp in the first PCR and 540 in the second run

I would appreciate your help!!

Thanks Tharom