Promoter Sequences - E.coli sequence & determining the promoter (Nov/13/2006 )

How do I figure this out?

Shown below are sequences for an E.coli gene where the lower case letter indicates +1. Find the promoter sequences for this gene and justify the answer.

TGCAAATTGGGAATGTTTGCAATTATTTGCCACAGGTAACAAAAAACCAGTCCGCGAAGTTGATAGAATCCCATCatCTC
GCACGGTCAAATGTGCTTTTT

Please help me! I don't understand. Thanks:)

-britneys-

If this is a homework question, I would give you a hint. Look for certain sequences at the promoter at -10 and -35.
Mods, put this in the homework section.

-tap14-

QUOTE (tap14 @ Nov 13 2006, 04:23 PM)

If this is a homework question, I would give you a hint. Look for certain sequences at the promoter at -10 and -35.
Mods, put this in the homework section.

Do you mean to count back from the small at 35 and 10. I don't really understand the whole -35 and -10 stuff that we have been learning.

-britneys-

QUOTE (britneys @ Nov 13 2006, 05:22 PM)

QUOTE (tap14 @ Nov 13 2006, 04:23 PM)

If this is a homework question, I would give you a hint. Look for certain sequences at the promoter at -10 and -35.
Mods, put this in the homework section.

Do you mean to count back from the small at 35 and 10. I don't really understand the whole -35 and -10 stuff that we have been learning.

Promoters have the same sequence (for the most part) from one gene to the next. Do you have this sequence written in your notes?

-Patty4150-

QUOTE (Patty4150 @ Nov 13 2006, 09:57 PM)

QUOTE (britneys @ Nov 13 2006, 05:22 PM)

QUOTE (tap14 @ Nov 13 2006, 04:23 PM)

If this is a homework question, I would give you a hint. Look for certain sequences at the promoter at -10 and -35.
Mods, put this in the homework section.

Do you mean to count back from the small at 35 and 10. I don't really understand the whole -35 and -10 stuff that we have been learning.

Promoters have the same sequence (for the most part) from one gene to the next. Do you have this sequence written in your notes?

Yeah it's supposed to be TATAAT but that is not in this sequence. We thought maybe it was mutated?

-britneys-