Best free program for pairwise local alignment (DNA) - Any advice? (Sep/29/2006 )

I have two mRNA sequences with (allegidly) 75% sequence homology. I need to create primers for one which will give me a PCR product which is unique to that gene.

I need a free program which will allow me to compare both sequences in this format

1 ACCATGTGACGTACGTAGATTACACC 26
| | | | | | | |
26 ACGTGATCACGTGATGCCGTAGATAA 1

I KNOW that this program exists because I used one two years ago, but I don't remember which. Any suggestions?

Rosie

I think either Needle or Water from EMBOSS does what you're looking for. Both are available here. NCBI's BLAST server, used to align two sequences (see here), also will do what you're looking for.

All of these programs are web-based, but each of them is also available for download for local or programmatic use...

Thanks that was EXACTLY what I needed. I spent most of this morning fruitlessly searching for that!