about mutant plasmid construction - (Sep/16/2006 )

Hi, everyone:

Recently, I have worked on the point mutant experiments using QuikChange Site-Directed Mutagenesis kit (stratagene com). But I can not get my desired plasmid. Here's my PCR condition:
95 degree, 30 min (1 cycle)

95 degree, 30 sec
55 degree, 1 min
68 degree, 6 min (pcDNA 3.1 containing the gene is between 5 kb and 6kb)
18 cycles.

68 degree, 10 min

Then add 1 ul DpnI to digest the methylated parental plasmid at 37 degree for 1~2 h.
Then transform and plate according to the protocol.

But unfortunately, I sent 3 samples for sequencing and they were original wild type plasmids.

I hope to get your help. Any suggestion and directions are welcome!

Linksky

---

you mean 95 C for 30 sec not 30 min in the first cycle right??

I'm using the same kit with the same plasmid and it is perfect.

what are your primers and what are thier Tm?

I use 20 ng plasmid in my reaction with 12 cycles with 6 min extension and it works fine.

so, what conc of plasmid and primers do you use?
and what is that step at the end they don't say that in the manual !!!

try to follow what they recomment in the manual exactly for point mutation if you are doing point mutation and don't add any extra steps, it might work.

good luck

---

Incubate your DNA template with the PCR buffer etc (without Taq and primers that you can spare), then add DpnI and digest. Load it on a gel and check whether you still have DNA. If you still have it, DpnI didn't work...

---

Thanks for your reply.

I mean 95 degree 30 sec.
These are the primers I designed:
BRM-1
***********
Forward:5'GAGCGACGAGTACAAGGCGCGGCGCGCGCGCAACAACATCGC 3'
Reverse:5'GCGATGTTGTTGCGCGCGCGCCGCGCCTTGTACTCGTCGCTC 3'
***********
GC content: 69.05% Location: 350-391
Melting temp: 67.7°C Mismatched bases: 11
Length: 42 bp Mutation: Substitution
5' flanking region: 16 bp Forward primer MW: 12978.54 Da
3' flanking region: 15 bp Reverse primer MW: 12857.43 Da

BRM12
**
Forward: 5' CGAGCGCAACAAC[/color]GCCGCGGTGCGCAAGA 3'
Reverse: 5' TCTTGCGCACCGCG[/color]GCGTTGTTGCGCTCG 3'
**
GC content: 68.97% Location: 254-282
Melting temp: 79.5°C Mismatched bases: 2
Length: 29 bp Mutation: Substitution
5' flanking region: 13 bp Forward primer MW: 8931.90 Da
3' flanking region: 14 bp Reverse primer MW: 8868.83 Da

After PCR, I run the gel and the weak PCR band can be detected.
The BRM12 clones usually can be seen but less than 30.
And I will delete the last step (68degree ,10 min)?

The conc of the template is just according to the protocol: I used 20ng and 50ng.

I will try again, Thank you .

---