about the primers in MSP - (Aug/12/2006 )

Hi
Recently, I found an articles, titled "Hypermethylation in Human Cancers of the RIZ1 Tumor Suppressor Gene, a Member of a Histone/Protein Methyltransferase Superfamily" in Cancer Research. At the "Bisulfide Modification and MSP" of this article,the primers are the following;

RIZ1 MSP (M) F:GTGGTGGTTATTGGGCGACGGC R: GCTATTTCGCCGACCCCGACG
MSP (U) F:TGGTGGTTATTGGGTGATGGT R: ACTATTTCACCAACCCCAAGA
.
As above, the red "G" is not "C",why? Could somebody explain it for me?

it's most likely a typo error, if replicating a published assay I usually check and double check primer sequences before going ahead with the study as they are the easiest to have typos.

Nick

Hi,karyotyper and Nick

Thanks for your replies.
I thought it was a typo error firstly. however , I found another article, titled " Detection of Hypermethylated RIZ1 Gene in Primary Tumor,Mouth, and Throat Rinsing Fluid, Nasopharyngeal Swab,and Peripheral Blood of Nasopharyngeal Carcinoma Patient". This apper has the same primers. So I was not sure it must a typo error.

The second paper has used the primer sequences from the first paper (referenced). One of the primer sequences must still be wrong because the M and U reverse primers are derived from the same sequence of DNA.

I'm guessing the G should be a C in the U reverse as you have suggested. You could try emailing the authors of the first paper for clarification (or try seaching for the sequence in your area of the gene of interest (you'd need to "bisulphite convert" the sequence before searching though).

Karyotyper
Thanks for your suggestion.
I have written to the author of the first paper .
If it is a typo error ,the second paper's result is very sceptical.