Success with Direct Sequening of Bisulfite Pcr Products - (Mar/24/2006 )

Pages: Previous 1 2 3 4 5 Next

Hi I am a new member here. I am currently optimizing bisulfite sequencing as well and notice that the reverse primer works only. and I think primer is the most important factor that affect the sequencing result..I have problem in repeated regions as well and I think the sequencer can't read and the data is very messy though the PCR works..

-craie-

Hi Nick,

I ran my PCR amplicons in a 1.5% agarose gel and cut out the bands. I used the good old standard Qiagen QiaQuick Gel Extraction Kit to purify and send off my ampicons for sequencing as I do with all normal PCR amplicons. I guess I lucked out and didn't have to do any special cleaning to the DNA. Prior to doing the PCR, I used EZ DNA Methyl Gold kit which does the bisulfite reacton and cleans the DNA too. So far it's worked successfully. I'm happy it wasn't so difficult as I'm the only one doing methylation studies in my lab.

But I just noticed today after re-evaluating my data, that in one sample (0.5ug sample) there was one CpG that was methylated in BOTH the forward and reverse directions. Earlier I wrongly mentioned that it was only the reverse direction. None of the other samples showed this. All the samples are from the same original Tumor biospy. It's only one methylated CpG. Is that enough to cause promotor silencing???
Thanks

-purplefetus-

QUOTE (purplefetus @ Apr 20 2006, 09:53 AM)

It's only one methylated CpG. Is that enough to cause promotor silencing???

It is very possible that is the case, that site maybe a crucial transcription factor binding site that when methylated perturbs TF binding, there are many papers that demonstrate this.

Thanks for the details on what you did.....

Nick

-methylnick-

Thanks for the insight Nick,

Btw, I did another methylation on a normal skin sample from the same patient. I found those same questionable CpG's to also be methylated on the sequencing electropherogram data. So it's probably a normally methylated CpG. Oh well, no big findings here.

-purplefetus-

that is always the case, that nature paper will come with the next discovery :-)

-methylnick-

QUOTE (phage434 @ Mar 26 2006, 05:09 PM)

The bisulfite conversion process creates non-complementary strands of DNA, because the non-methylated C's are converted to T's, while the G's on the complementary strand stay unchanged.

Unless the subsequent amplification process is strand selective, this results in a mixture of PCR products. When sequenced, these do not give a clear picture of the methylation status of the C's, instead giving reduced height mixtures of C and T, and similar reduced height mixtures of G and A.

The solution to this is to use primers for the post-conversion PCR which are selective for converted bases. Specifically, you can design primers which are selective for the forward strand, and a distinct set of primers selective for the reverse strand. This only works if you have some knowledge of the location of methylated bases. Ideally, you would want a converted base at the 3' end of each primer, and perhaps a few more in the middle. Designing these requires careful thought.

The non-strand-selective PCR primers can be used to amplify converted DNA, but to get accurate methylation status, the PCR product has to be cloned, which will select a single product molecule and amplify it sufficiently for subsequent sequencing, avoiding the problem of sequencing a mixed set of products. In principle, half of these clones will show the forward strand converted, and half the reverse strand converted.

You should be aware that PCR reactions for converted DNA have a template with unusually low GC content. Many times, this requires a PCR *extension* (not annealing!) temperature which is substantially lower than the normal PCR temperatures of 72C. I use 64-66 C for these and lengthen the extension time.

Hi Phage, when you talk about selected for converted bases would you consider this a proper primer design to ensure amplification of converted sequences...

For example...

5' GAGGCCAAAGGCTGAACCCAATG 3'
3' CTCCGGTTT CCGACTTGGG TTAC 5'

Followed by Treatment with bisulfite we have

5' GAGGUUAAAGGUTGAAUUUAATG 3'
3' UTUUGGTTT UUGAUTTGGGTT AU 5'

Now to desing the top primer should I try to use the converted sequence as the template (antisense), if I dont care about the sequence change, where this ensures amplification of converted sequences....

So my 5' primer would be based on the converted antisense strand...

5' AAAACCAAAAACTAAACCCAATA 3'

Thanks for your help...

Kevin.

-TheGlassMan-

QUOTE (craie @ Apr 20 2006, 12:02 AM)

I have noticed the same thing: longer and better sequences by using the reverse primer. Can anybody think of a reason behind this mistery?

-Bram-

A colleague of ours recently published a paper on the use of tagged direct bisulfite sequencing in lieu of cloning or standard direct sequencing as a way of increasing fidelity of the sequencing reaction. Hope you find this useful.

Spivak SD, DNA methylation mapping by tag-modified bisulfite genomic sequencing, Analytical Biochemistry June 2 2006

-cancergeek-

QUOTE (cancergeek @ Jun 28 2006, 08:20 AM)

Thanks cancergeek, have read the paper and ordered the primers for my genes. will let you know if it works.

Bram

-Bram-

the epigenome project group use direct bisulfite sequencing and use ESMS software to read the sequence. the software is free to download, but it works only in linux, so i can not use the software. you can search Human Epigenome Project HEP to access that.

for me, i try directly sequence, but the sequencing results is very dirty, i can not expect software can give correct quantitation results(not only +/-). it is the reson why i am using TA sequencing and pyrosequencing.

but the epigenome project always do this way, and they have paper in nature genetics. so they should have some technique trick.

i hope in short future, direct sequencing will be feasible.

-gaodaxia-

Pages: Previous 1 2 3 4 5 Next