how to determin the Annealing Temp of ristriction sites modified primer? - help me ! (Mar/23/2006 )
I use Primer3 to select my primers, then add whatever 5' bases I'm adding, and order them. I don't order two sets of primers, just the one. So, borrowing from a prior post, if Primer3 selected taataaatttccacacacgcagac, and I wanted to add a XhoI site to it, I would add my XhoI site (ctcgag) preceeded by 4 irrelevant bases (caga), and order:
cagactcgagtaataaatttccacacacgcagac
I would use this primer (with another matched to it, picked at the same time and similarly modified) in a PCR reaction with an annealing temp of 55°C or so.
I also use Primer3 to choose the primers, add the 5' restriction site (s), but then add the 5' tag GTTTCTT which serves two purposes. If I want to cut and ligate, then it is the sacrificial tag (similar to the CAGA Homebrew uses). If I want to Topo TA clone, then this tag has been shown to facilitate 3' addition of A in a Taq based PCR reaction. See:
Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques. 1996 Jun;20(6):1004-6, 1008-10. PMID: 8780871
Hi HomeBrew and phage434:
Thanks for your reply.
I wonder that whether you avoid adding the same ristriction sites ( say, XhoI) on 5' end of both forward primer and reverse primer? Why?
To Phage434:
Another problem: is the Dummy sequence you choose as the 5’ tag too long? whether they affect the PCR product?
According to the Tech-material given by Finnzymes, GTTTCTT is not the efficient end to faciliate the Taq DNA polymerase to add a non-template to the 3' end of PCR product.
I think we're straying back into too much work again... 
I have never found the need to use a special tag for TA cloning. We do occasionally need to TA clone the PCR product for some enzymes that require a lot of 5' bases (like NheI, I think). When that's the case, we use a TOPO TA kit (Invitrogen) and clone it in (usually to pCR2.1). Using my standard "reverse and add the last four bases of the primer to the 5' end" standard method, I've rarely had the TA kit fail me (I hesitate to say "never", but I honestly can't recall the last time I had a TA cloning fail...).
We usually use the same restriction enzyme site for the 5' end of both primers, but mostly this is because we usually don't care about insert orientation. In fact, most of the experiments I've been describing actually involve two PCR reactions and a three-way ligation (vector, left flank, right flank). So, in this case, the four primers involved are usually modified to produce PCR products as follows:
X---------------------Y Y---------------------X
So, the outermost primers both have X as an enzyme site addition, and the two inner primers have a Y site added. We'll combine these products with a suicide vector cut with enzyme X, and use the construct to create a mutant by allelic exchange.
Of course, when insert orientation does matter, we'll either use the same enzyme sites on both primers and screen with a vector-based primer and one of the insert-generating primers, or we'll use a different enzyme site on each primer.
Mostly, we do single enzyme modification to each primer, because (1) our vector has very few sites available for cloning, and (2) we prepare large amounts of cut, cipped, and gel-purified vector ahead of time and hold it at -20°C, so single-cut vector is already ready to go.
I have never found the need to use a special tag for TA cloning. We do occasionally need to TA clone the PCR product for some enzymes that require a lot of 5' bases (like NheI, I think). When that's the case, we use a TOPO TA kit (Invitrogen) and clone it in (usually to pCR2.1). Using my standard "reverse and add the last four bases of the primer to the 5' end" standard method, I've rarely had the TA kit fail me (I hesitate to say "never", but I honestly can't recall the last time I had a TA cloning fail...).
We usually use the same restriction enzyme site for the 5' end of both primers, but mostly this is because we usually don't care about insert orientation. In fact, most of the experiments I've been describing actually involve two PCR reactions and a three-way ligation (vector, left flank, right flank). So, in this case, the four primers involved are usually modified to produce PCR products as follows:
X---------------------Y Y---------------------X
So, the outermost primers both have X as an enzyme site addition, and the two inner primers have a Y site added. We'll combine these products with a suicide vector cut with enzyme X, and use the construct to create a mutant by allelic exchange.
Of course, when insert orientation does matter, we'll either use the same enzyme sites on both primers and screen with a vector-based primer and one of the insert-generating primers, or we'll use a different enzyme site on each primer.
Mostly, we do single enzyme modification to each primer, because (1) our vector has very few sites available for cloning, and (2) we prepare large amounts of cut, cipped, and gel-purified vector ahead of time and hold it at -20°C, so single-cut vector is already ready to go.
Hi, HomeBrew:
Many Thanks to you for your kind and detailed explanation and guides
I seldom use Primer3 to design my primer, for I am a novice in Molecular Biology.
Do you have some mannual of Primer3.
Besides, Yesterday, I try to select primers through Primer3 （online Version）. Would you like to help me to estimate this pair of primers? My primers is attached in the file attachments
You select primers of both Genomic DNA and cDNA Via Primer3?
Thanks a lot in advance!
Well, with regards to the question we're discussing (annealing temps of primers with 5' modifications), it doesn't matter how your primers are selected...
But, your primers look fine (I guess -- I don't know anything about what you're trying to do). If the primers you suggest are in the right spots for your experiment, then they're fine statistically:
LEFT PRIMER 382 20 60.25 55.00 5.00 3.00 ccccagccacaaagagtcta
RIGHT PRIMER 4703 20 61.05 50.00 5.00 2.00 acgaccaggttttccagctt
PRODUCT SIZE: 4322
Again, I don't know your experiment, and I didn't look for orfs or anything, so I don't know how rigid your experiment is with regards to primer positioning. But, it you can tolerate the reverse primer being a hundred or so bases further along, this set is a bit better matched to one another:
LEFT PRIMER 382 20 60.25 55.00 5.00 3.00 ccccagccacaaagagtcta
RIGHT PRIMER 4819 24 60.70 45.83 5.00 3.00 ccattagaacacatcactgtggac
PRODUCT SIZE: 4438
Either set will work fine.
As far as a manual goes -- the only one I know of is here. This is the same document you get if you click on one of the input links. BTW, I rarely change any of the default settings except for Product Size (Min, Opt, and Max) and Primer Size (Min, Opt, and Max).
Also, just so you know, many people have reported problems trying to clone with XhoI. I have no personal experience with this phenomena (mostly because I haven't tried to clone a XhoI fragment in several years
), but it does seem to come up here as a topic fairly often. A recent example is here... But, your primers look fine (I guess -- I don't know anything about what you're trying to do). If the primers you suggest are in the right spots for your experiment, then they're fine statistically:
LEFT PRIMER 382 20 60.25 55.00 5.00 3.00 ccccagccacaaagagtcta
RIGHT PRIMER 4703 20 61.05 50.00 5.00 2.00 acgaccaggttttccagctt
PRODUCT SIZE: 4322
Again, I don't know your experiment, and I didn't look for orfs or anything, so I don't know how rigid your experiment is with regards to primer positioning. But, it you can tolerate the reverse primer being a hundred or so bases further along, this set is a bit better matched to one another:
LEFT PRIMER 382 20 60.25 55.00 5.00 3.00 ccccagccacaaagagtcta
RIGHT PRIMER 4819 24 60.70 45.83 5.00 3.00 ccattagaacacatcactgtggac
PRODUCT SIZE: 4438
Either set will work fine.
As far as a manual goes -- the only one I know of is here. This is the same document you get if you click on one of the input links. BTW, I rarely change any of the default settings except for Product Size (Min, Opt, and Max) and Primer Size (Min, Opt, and Max).
Also, just so you know, many people have reported problems trying to clone with XhoI. I have no personal experience with this phenomena (mostly because I haven't tried to clone a XhoI fragment in several years
), but it does seem to come up here as a topic fairly often. A recent example is here...Hi HomeBrew:
Thanks for your patient reply! I am so grateful you help me to check my primers
I just want to clone a part of the Target Gene to make a fusion gene with 6xHis, The amplicon between the Primers just a part of the Gene Entire sequence of my interest. The reverse Primer just position in the 10th exon of this gene. 'Cause, I want to add a 6X His tag on the C terminals of the Protein. So the lower primer has to locate in the Exons. Unfortunatly,4819 is in the 10th intron.
"Many people have reported problems trying to clone with XhoI." My God, My mammlian expression vector provide only XhoI Sites for exogenous insert! What a terrible news! Is there some good ways to improve the successful chance of XhoI CLONE?