Sod the sequencing - (Mar/15/2006 )

Hello you two,

For about two months my colleague and I have been trying to sequence a fragment of converted DNA and we haven't got anywhere. I have attached two documents showing the original and converted sequence and the primers we have been using. We use the protocol described on MD Anderson's website and digest our DNA with either Hinf1, HindIII or Nhe1. The PCR protocol we used is the one described by you, being (5+25)x2 for the nested PCR. We use hot start enzymes. When we check the bands after the first round of PCr on a gel we seem to be getting several bands (some of the right size) but gel purification and sequencing only gives us rubbish.

What are we doing wrong?

Cheers,

Bram

---

PS These were the actual primer sequences:

External FP: GTGGGGTGGGTTTATTTGTG
External RP: CACACAACCCTTATCATATACCC

Internal FP: GAAAAAGAATGGGTAAAGAGGTTGT
Internal RP: CCAATCAATCACAACCCTTACA

---

direct sequencing is a very challenging method to tackle, to be safe you can clone into a vector and sequence a few to see what you get.

if you want to continue with direct sequencing, for some reason, the forward primer will never work for sequencing (something to do with base composition) so focus your efforts using the reverse primer.

For a safe bet, I would go ahead and clone into something like pGEM and sequence a handful of clones before diving into direct seqeuncing.

nick

---

I've been troubleshooting some bisulfite sequencing myself and came across this post (note that it is a few months old, we may be too late to help Bram!).

I've had a look at Bram's primers, and from my understanding, the external primers are designed to amplify only one DNA strand, in this case the bottom one. Going from the sequences Bram has given, the forward external primer (External FP: GTGGGGTGGGTTTATTTGTG) would amplify the bottom strand pre-bisulfite treatment, while the reverse primer would amplify the bottom strand after bisulfite treatment.

Is this correct or am I getting confused?

---

indeed you are correct,

it's always a strand specific PCR with bisulfite, because after conversion the strands are non-complementary. indeed, the forward primer will bind to the bottom strand while the reverse would not be able to bind to anything until the bottom strand is copied in the initial rounds of amplification, once copied though, you then get into the exponential amplification phase and you see a nice distinct product!

Nick

---

I think you're getting confused Davo

The external forward primer (given in the second post on march 16) will applify the top strand. It is no longer complimentary to the bottom strand after bisulphite conversion (although it only contains one converted C that makes it different to the non-treated DNA).

The external reverse primer will bind to the top strand and amplify 5'->3'. Once this amplification is complete the external forward primer can then bind to this newly synthesised strand and successfully amplify back the other way. Then away goes your PCR.

HOWEVER, I have noticed that the reverse primer contains a CpG and the primer has been designed so that this C is converted to a T (ie. unmethylated). This will bias the reaction towards unmethylated DNA at this base. The external reverse primer should have designed with a wobble (A/G) at this base to help prevent bias.

I think both external primers are poorly designed for BSP. Don't have time just at the moment to look at the internal ones......

---

OK, I’ve had a chance to look at the internal primers as well now. The internal forward is OK except that it contains a CpG that has been designed so that the C converts to a T (again this will favour non-methylated DNA at this base and is therefore poorly designed for BSP). The internal reverse primer “designed” for the upper strand has no converted bases within the sequence so will amplify both converted and non-converted DNA.

Hope this helps.

---

Hi Guys,

thanks for all your help. Have tried the pGEM vectors and they work a treat. I have attached our latest results where you can see the difference between the different cell lines for one gene. I had a go at direct sequencing using tag primers but they haven't worked yet. Anyone done any work with them?

Bram

---

Invitrogen's TOPO line works great too...

---

Ahhh yes, I see it now. Thanks for clearing this up karyotyper.

Sometime I'd like to draw the whole thing out in all its detail, but I think I'd need a sheet of butchers paper!

---