multiplex pcr trouble - some bands won't amplify (Nov/29/2005 )
i have a multplex pcr reaction that should give 5 bands: 2200, 1750, 1350, 900 and 700 bp products. i have no problems amplifing them when separated, but when i use them together only the 1350, 900 and 700 amplify (sometimes the 1750 amplifies weakly). ive tried raising the concentration of the "weak" primers, but i still cant get it. any suggestions for this pregrad thesis student???
Could you write out a list of the total reaction contents, o hammer of Thor?
yes, actually, i could 
for 25 uL:
- 1.5-3.0 uL Mg+2 (50mM)
- 1.25 uL dNTP (10mM each)
- 0.25 uL taq
- 0.8-2.0x buffer
- 0.2-1.5 uL each primer (10mM) depending on which one
- 0.5 uL DMSO
- 0.5 uL PCR enhancer
- 2,5 uL DNA (i'm not sure of the concentration, the spectro has been out of order for a while now, but i've tried dilutions of it until i found the one that work in simpleplex...)
does this help, oh super hero of the double helix?
Hmm have you checked for possible dimers between the primers of the bands that do not amplify? Perhaps, since they amplify well alone but not together, that there is an interaction between the primers. Do you have identical restriction sites on some of the 5' ends?
for 25 uL:
- 1.5-3.0 uL Mg+2 (50mM)
- 1.25 uL dNTP (10mM each)
- 0.25 uL taq
- 0.8-2.0x buffer
- 0.2-1.5 uL each primer (10mM) depending on which one
- 0.5 uL DMSO
- 0.5 uL PCR enhancer
- 2,5 uL DNA (i'm not sure of the concentration, the spectro has been out of order for a while now, but i've tried dilutions of it until i found the one that work in simpleplex...)
does this help, oh super hero of the double helix?
yeah, the primer design was done very carefully, but i could always check by amplifing by two's 
Could be a good start! I have spare time when I get home if you want to paste in the primer sequences...since I have no life out of lab! I would also double check the Tm even though I am sure you've taken this into account when designing them.
awwwww.... you're so sweet 
CCGACTTGTCCCGAAACTGTCCA
TCAGGCAACAAACCGATTGACGTTC
CCTTCGTATGGAGACGGATGAGCAC
CTGCAGCTGGATGGTCGGATAGA
GACGATCACGTTGGGATGCAGC
AAAAGAGGATGAAGGGGATTTGCGA
GATCTTTGCCCGCGGTTGAAGG
CAGATGCGTGACTGGCGAATGC
CGGGTCTTCACGGAAGAACAAGGTATT
ACAAGCTCATTTTCTGGATCGTGGC
the tm works for them all between 65 and 68 degrees celcius in simpleplex....
we designed them using a multiplex designer programme designed by our bioinformatic professor here, and they usually work, so i don't think it would be a problem, but i guess double checking wouldn't be so terrible (tho i doubt my professor can finance a new set of primers, Chile is a poor country and labs here don't have much cash )
most of us don't have much life outta the lab, i guess 
Fantastic, I will take a look at them after work.
Oh the template sequence might be useful too, lol. As for the price of new primers, I don't know how much it costs you from your source but we get ours from www.IDTDNA.com and I think it ends up costing ~$0.35 a base and I'm sure you can find lower. I've heard as low as $0.15/base but I have yet to find that place.
*Edit* Also what temps are you using in your cycles?
www.operon.com
they split off from Qiagen about 1.5 years ago
.25/base, 50nM standard desalted prep; $10 shipping per order