Nested primer PCR - (Nov/12/2005 )
Hi,guys,now I’m studying the CpG islands methylation status of CDKN2B .I get the mRNA sequence of P15 from NCBI,about 4001 bps.I put it into the Methprimer program,and get 9 pair methylated and unmethylated primers,in the attachment. I had originally attempted to design nested primers, but have now turned to hemi-nested due to the lack of suitable primer sites.I set the first round primer as follows:
2 Left M primer 184 24 59.17 79.17 9 GGTTATTGTACGGGGTTTTAAGTC
Right M primer 390 25 58.33 60.00 5 ACTAAACATACCCTTATTCTCCTCG
Product size: 207, Tm: 75.6
Left U primer 184 25 59.09 80.00 9 GGTTATTGTATGGGGTTTTAAGTTG
Right U primer 391 27 59.77 62.96 5 CACTAAACATACCCTTATTCTCCTCAC
Product size: 208, Tm: 70.8
And the second round primers:
9 Left M primer 197 24 59.62 70.83 6 GGTTTTAAGTCGTAGAAGGACGAC
Right M primer 390 25 58.33 60.00 5 ACTAAACATACCCTTATTCTCCTCG
Product size: 194, Tm: 75.4
Left U primer 196 25 58.19 72.00 6 GGGTTTTAAGTTGTAGAAGGATGAT
Right U primer 391 27 59.77 62.96 5 CACTAAACATACCCTTATTCTCCTCAC
Product size: 196, Tm: 70.6
Could some one help me to check if it is OK! If not ,how could I design my primer?Thank you very much!
MSPnewer.
they look fine to me, you should try them out and see what you get.
generally speaking, the first round of PCR involves a degenerate set of primers that are not specific to methyhlation or unmethylation, its the second round that are MSP.
however I have not tried this and I think your setup should work quite well.
Nick
generally speaking, the first round of PCR involves a degenerate set of primers that are not specific to methyhlation or unmethylation, its the second round that are MSP.forward
however I have not tried this and I think your setup should work quite well.
Nick
HI,Nick,I have try it in my expriment.I could get a beautiful band in HL-60 cell line with the unmethylated primers at 56 degree。However，I could not get any bands with the methylated primers in MOLT-4 cell line at 56~60 degree.I now am so depressed that I donn't know what should I do next.Could you help me ,please!!Do you think that I could get a methylated band if I could get a unmethylated band? How should I optimize my PCR condition?Thank you in advance,looking forward to your answer!
i noticed you are using mRNA sequence, do your primers happen to span an intron by any chance, this is an oversight on my part, you should have designed primers with genomic DNA. Seeing that your primer sets are at the 5' end this should be a problem but you should check nevertheless.
are you expecting you CDK gene to be methylated in MOLT-4 cells? Did your unmethylated primer set work for MOLT4 DNA? if not then I would suspect that your MOLT4 bisulfite conversion has failed.
However if you are seeing your unmethylated primer set coming up in MOLT4 that would suggest that that particular region is unmethylated.
I am not a cancer specialist however I am aware that some genes are hypermethylated while some are hypo, could it be that CDK is hypomethylated? (without looking into pubmed about it)
Nick
are you expecting you CDK gene to be methylated in MOLT-4 cells? Did your unmethylated primer set work for MOLT4 DNA? if not then I would suspect that your MOLT4 bisulfite conversion has failed.
However if you are seeing your unmethylated primer set coming up in MOLT4 that would suggest that that particular region is unmethylated.
I am not a cancer specialist however I am aware that some genes are hypermethylated while some are hypo, could it be that CDK is hypomethylated? (without looking into pubmed about it)
Nick
Thank you for your quick answer,Nick.I put the mRNA sequence and the genomic DNA in the
Methprimer program and they get almost the same primers!What do you mean "my primer sets
are at the 5' end this should be a problem "?I have looked into the PUBMED that they usually set
the MOLT4 cell line which is fully methylated as positive control and HL60 as negative for CDKN2B!
And i also could not get a band in MOLT4 with the unmethylated primer.And i am still check my
MOLT4 DNA.
Do you think that my My M-primers will work if my uM-primers work well?If so ,i will try it some
days!And how do you optamize your PCR system if you can get and bands? I am so nervous that i
will graduate in months.Please help me ,thank you very much!
MSPnewer.
oops sorry, it was a typo error, it should have read "shouldn't be a problem"
was of optimising your primers is to perform a gradient PCR to optimise annealing temp conditions this would be your port of call, we didn't have gradient machines and I worked by performing multiple PCRs with different Tm's to get an optimal cycle condition.
One thing to do is to check that your DNA is MOLT4 gDNA or if in fact your cell line is MOLT4. If your primers work for USP primer set your M primer set should work, provided your template was methylated in the first place.
Nick