olligo annealing for shRNA cloning - (May/26/2009 )

Hi,

I'm doing a PrP knockout using the siRNA pLKO.1 Cloning Vector which I bought from Addgene. The company is courteous enough by providing us a full scale protocol. There has been no problems with performing the dual digestion of the pLKO.1 by following the protocol, where the 7kb band can be visualized after running the agarose gel.

However, after transformation, there is no colony occurs on the plate. Hence, we suspect there is problem with the oligo annealing and/or the T4 ligation. According to the protocol, oligo is suspended to a concentration of 20uM then the following mixture were created:
5ul Forward oligo
5ul Reverse oligo
5ul 10x NEB buffer2
35ul ddH2O

4mins PCR incubation at 95^oC. Then 70^oC for 10mins. Cool down oligo to RT over periode of several hours.

Since this protocol didnt produce us with any results, we shift to advanced method using PCR with the following condition:
95^oC 5min
95^oC (-1C/cycle) 1min 35cycle
60^oC 30mins
60^oC (-1C/cycle) 1min 25cycle
4^oC Hold
Sadly, there's no successful annealing as well. We have even try out the water bath condition by incubation at 95^oC for 10mins and let it cool down to RT.

Below is the information regarding our primers:
Forward Primer (5’-3’)
HuPrPRNAi1: CCGGAATGCCCTATCTTAGTAGAGACTCGAGTCTCTACTAAGATAGGGCATTTTTTTG
HuPrPRNAi2: CCGGAAGGCAAATCTCCTTTGTCCACTCGAGTGGACAAAGGAGATTTGCCTTTTTTTG

Reverse Primer (5’-3’)
HuPrPRNAi1: AATTCAAAAAAATGCCCTATCTTAGTAGAGACTCGAGTCTCTACTAAGATAGGGCATT
HuPrPRNAi2: AATTCAAAAAAAGGCAAATCTCCTTTGTCCACTCGAGTGGACAAAGGAGATTTGCCTT
For your information, I have two pairs of primers with melting temperature around 60^oC.

Anyone have any suggestions on this? By the way, how could one determine the successful of oligo annealing? Thanks thanks for any feedback.

Hi,

Oligo cloning is straight forward with high success rates.

When doing oligo annealing, you don't need to use a PCR machine and a complicated program. I just heat a big beaker of water to 94 degree and throw the mixture in the water to allow the water to gradully cool down to 37C and then maintain at 37C for one hour. After annealing, run an agarose gel to check if there is ds-oligo by running ss-oligo and the annealed oligos side by side.

Make sure both enzymes cut the vector. Set up a reaction with just one enzyme added.

After ligation, run a gel with 4-5 ul of ligation reaction to see if the ligation is successful or not.

Did you get colonies from positive transformation? I hope you have included it.

My experience is: Check every step (which you can) before proceed to the next step.

Good luck!

Hi,

agree with pcrman. oligo annealing should not be the problem. i also basically follow the procedure of pcrman. heat mixture to 95°C for 1min, and further incubate for 1hrs at 37°C.
after this check the annealing on an agarose gel.
was it necessary to resuspend your oligos? If so, you might also measure this in a uv spec. to make sure you work with the concentrations suggested.
i recently used the cloning strategy from ambion (pSilencer manual) maybe it's worth taking a look into the manual and follow their procedures. for me, this worked very efficient.

good luck

I agree with Bomber, Ambion's protocol works great.

I guess you use too much vector and annealed oligos. Sometimes, more is not better.

Here is the link I download the protocol, it works very well to me.
http://biosettia.com/php/01-plv-rnai/protocols

1. In a 1.5 ml microcentrifuge tube, set up the annealing reaction in total 20 μl mixture as following:
10 μl 100 uM single-strand oligo
2 μl 10× annealing buffer
8 μl distilled water

2. Incubate the DNA oligo at 95°C for 5 minutes (water bath is better than heat block).

3. Remove the tube from the water bath and allow the reaction mixture to cool to room temperature for 10 minutes.

4. Dilute 1 μl annealed double-strand oligo in 499 μl distilled water, vortex for 5sec.

Optional: Load 20 μl of diluted oligo onto 4% agarose gel (FMC Bioproducts, NuSieve GTG Agarose Catalog No. 50082) to determine annealing efficiency.

5. Mix 1 μl (25 ng) pLV-RNAi vector with 2 μl 500× diluted (50 nM final) double-strand oligo for ligation reaction (20 μl in total).

For lentiviral vector, please use DH5a or Stbl3 competent cells to prevent recombination. Other bacterial strains such as TOP10 and XL-1 will give you a lot of problems.
You should get hundreds of colonies when you transform 3-5 μl ligation mix from above.

Thanks for all the suggestions. I'll try to make up with it.

Dear all,

I have run a 4% agarose gel to determine for annealing succession, however both my primers and "annealed oligos" also showed two bands. What could be this means? Anyone have any suggestions regarding to this?

I have attached the gel picture as below. The first lane from the left would be my primer before annealing and the second and third lane from the left would be the oligo after annealing. Thanks for you feedback in advance.

You did not include DNA marker in your gel picture. It is hard to tell the size of the bands. I previously had a nice gel picture but could not find it any more. In stead I found one on Invitrogen site. It serves the purpose well.


After annealing, the dsDNA will definitely show up as a higher band than the ssDNA. In addition, you don't need to use that high (4%) concentration gel, 2% is enough.

Hmmm,

that looks weird.
One thing you might check, is the purity of your primers. In case you have a lot of degradation products left in your synthesized oligos it might hamper effective annealing.

My suggestion is just go ahead to do cloning to see whether you can get the right clone.