Protocol Online logo
Top : New Forum Archives (2009-): : PCR, RT-PCR and Real-Time PCR

how to predict amplicon size? - (May/09/2018 )

dear all

I would greatly appreciate if you help me know how to predict the amplicon size in conventional PCR using the sequences of forward and reverse primers? is there a website that can provide such info?

here are the sequences of alpha-tubulin primers used:

forward: ACACCTTCTTCAGTGAGACAGG
reverse: CTCATTGTCTACCATGAAGGCAC
thanks

-yobou-

Try the primer3 site - you can put in the sequence of your gene and add the primer sequences, so I should show you where these match.

 

Otherwise you can align them to the sequence using any number of alignment programs and note the places they bind.

-bob1-