problem with PCR amplification of cDNA - (Aug/05/2017 )

Dear all ,

I need to amplify, clone and express 657bp of viral RNA in bacterial system . I designed gene specific primers with buffer sequence, restriction sites and the complementary sequence along with start and stop codon. First , I isolated the RNA and  got value of 2.02 for 260/280 in nano drop and used the same for cDNA synthesis ,, then diluted it to 5 times for PCR amplification . Initially i tried in 58 and 59 degrees but i did not get any amplification. Then, tried at 53 degree for 32 cycles (with different dilutions of cDNA) and I got the amplification of 657 bp product but with non specific bands so i increased the temperature to 55 but i did not get any results for it ,,and i tried gradient too from 45- 53 degree but i haven't got any results . one thing is  that there was spurious amplification of nearly 100bp- 120bp  fragment in all the temperature profiles i worked out and bit confused with that.  can any one help me with this issue. and suggest me the annealing temperature

i have herewith attached the gel pics of RNA, cDNA and the amplification at 53 degree with 32 cycles , 54 degree with 4o cycles 58 and 59 degree.

primers designed

GCCTGA  GGATCC ATG GACAAATCTGAATCAACCAGTG (UNDERLINED SEQUENCE IS COMPLEMENTARY)

GCCTGA GAGCTC TAA TCAGACTGGGAGCACTCCA  (UNDERLINED SEQUENCE IS COMPLEMENTARY)

thank you in advance

If you are looking at Cucumber mosaic virus as the sequence suggests - you need to reverse complement the sequence for the binding bit of the reverse primer - just complementing doesn't work.

bob1 on Wed Aug 9 14:04:40 2017 said:

If you are looking at Cucumber mosaic virus as the sequence suggests - you need to reverse complement the sequence for the binding bit of the reverse primer - just complementing doesn't

hi thank you for the reply and I am indeed using the reverse complementary sequence for the reverse primer . Even though I changed the primers still I could get the same 100 bp amplification so prominent along with my gene size

The bright bands at the bottom of your lanes will be primer dimers. There isn't much you can do about these, and these should not get digested and insert into your vector when you go through the rest of the cloning steps. If you are still worried, you can gel extract the target band and use that DNA for cloning.

bob1 on Thu Aug 17 13:42:34 2017 said:

The bright bands at the bottom of your lanes will be primer dimers. There isn't much you can do about these, and these should not get digested and insert into your vector when you go through the rest of the cloning steps. If you are still worried, you can gel extract the target band and use that DNA for cloning.

thank u .. but the bands are too faint .. so i hope it wont work for eluting .. i will try redesigning the primers ,,thank you again