Y-linker transgene integration site PCR primer verification - (Jan/02/2015 )

In the methods paper "A restriction enzyme-PCR-based technique to determine transgene insertion sites by Bryda, E. C. & Bauer, B. A. http://www.ncbi.nlm.nih.gov/pubmed/20013241" they use a Y-linker as an anchor for the second set of primers.

5’ -  GTGCAGCCTTGGGTCGCCGTGT/3InvdT/ Y-linker A

              ||||||||||||||||||||||

3’ – TCACGTCGGAACCCAGCGGCACATGGCAGGAGCGTAAATAGCAAACG Y-linker E

3’ -                        TGGCAGGAGCGTAAATAGCAAACG Y-linker primer D

3’ -             CCAGCGGCACATGGCAGGAGCGTA  Y-linker primer G

Since these sequences are listed as the primers required I am a little confused why they would suggest having the primers identical to the Y-linker E sequence and not complementary to it. Am I correct in assuming they expected the reader to get the compliment?

3’ -                        ACCGTCCTCGCATTTATCGTTTGC

3’ -             GGTCGCCGTGTACCGTCCTCGCAT

Seem really strange to make a protocol this complicated, or am I missing something really obvious?

The protocol is poorly described, in my opinion. The primers as described in the protocol are correct (and your swill not work).

Primer 1 and the initial "pcr" reaction is a single cycle reaction, and really just extends the restriction enzyme cut site, and (using Taq) adds the extra 3' A overhang.

The linker A and E anneal dsDNA is then ligated to the end (essentially a TA ligation).

PCR 2 is a normal PCR reaction using primer2 and linker primer D. It will amplify the region from primer 2 to the 5' end of Y-linker E (now ligated to your fragment).

PCR 3 simply amplifies again and is not logically necessary (but probably is necessary in reality). It amplifies from primer 3 to the 5' end of Y-linker primer G. This is your final product,which can then be sequenced.

Perhaps what is confusing you is that some of the sequences in the protocol (and in your diagram) are written 3' to 5', to show where they bind. When you order them, they will of course be written 5' to 3' (with the bases unchanged).

They don't make clear which of their primers are for PCR 1, 2, or 3. The first primer is the one furthest from the enzyme cut site, and encloses the 2nd and 3rd (in their example, primer R322 or primer F385). The second one encloses the 3rd. The notes make it seem as if these must be adjacent. That is not necessary. They just need to be nested in this way.

This is a complex protocol. Perhaps it is necessary for large genomes, but for bacterial genomes, inverse PCR would be the method of choice here.