DNA disappearing after restriction - (Sep/03/2014 )

Hello, my DNA appears as a bouble band after PCR (IMG_0035 PCR Products) which I suspect is a primer dimer but already I use 0.5 ul reverse and 0.5 ul forward primers/25 PCR reaction tube; my PCR product is 174 pb

 

Then after digestion with Taq I SmartCut from NEB (this is my second company for restriction enzymes) the DNA disappeared compeletely when I ran it in gel with only the ladder staying.

 

What do you suggest?

We can't say much. There isn't even a ladder on the gel image. My guess is that you are not loading sufficient DNA after digestion, but it is impossible to know given how little information you have provided about what you have done.

What is the sequence of the 174bp  product you are expecting?  How often do you expect the TaqI to cut within your sequence?  Where are the ladders for comparison on the gel?  (also, I think your gel picture may be upside down  )

I make a 10 ul restriction reaction as follows:

 

8 ul PCR product, 1ul Buffer, 1ul Taq I then I incubate for 30 minutes at 65 oC and stop the reaction either by heat (80 oC for 20minutes) or by 1ul 6X loading dye and I load the whole thing into the gel

 

CCTTCTTCTCTATCCCCGTGcccacagatcgtcctggggtgcaggacgccgcgctgat(T/C)

gaggccatccaggaccgcctgtccaacacactgcagacgtacatccgctgccgccacccgcccccgggcagccacctgctctatgccaagatgatcc

AGAAGCTAGCCGACCTGC
 

T(T) allele: 174 bp

C(t) allele: 58 bp + 116 bp

TC(Tt): 174 bp+58bp+116bp

 

Yes, my image is upside down XD

 

Next time I will run a ladder with the PCR priducts, I have done it previously but the documentation system wasn't available backthen soI didn't take a picture

 

Can these information help?

Well, this is poor practice for a digestion. You have 80% of your volume as DNA. This is bad, since DNA often has important contaminants such as ethanol or Gu-HCl, which can make digestions fail. There is a reason that your RE instruction sheet tells you to do a 50 ul reaction, where most of the volume is water.

 

This does not, however, explain where your DNA went. There should still be a DNA fragment visible on the gel, even if it were uncut. I still don't know what the gel you uploaded represents. Is it the PCR product, or the digestion product?

What percentage agarose gel are you using? Seeing such short fragments will be difficult without a high percentage gel, perhaps 2%.

A professor from another university suggested that my PCR product yield is low so they advised me to increase my DNA input in lieu of nuclease-free water. I made that amount to try and lower my material consumption until I reach an acceptable result.

 

The image is for PCR products in 1% gel, after digestion I ran the sample in 2 and 2.5 % gel

No images were in your posting. I don't understand. Either you have a correct length band in your PCR, or you don't. If you do, the problem is somewhere else. If you don't, then the problem has nothing to do with restriction digests, but with PCR. Which is it?

hercolanium on Thu Sep 4 20:10:31 2014 said:

A professor from another university suggested that my PCR product yield is low so they advised me to increase my DNA input in lieu of nuclease-free water. I made that amount to try and lower my material consumption until I reach an acceptable result.

 

What Phage was saying was that you should add more water and buffer, so keep the 8 ul DNA and add 36 ul water, 1 ul enzyme, 5 ul buffer.

 

Do you use a PCR clean-up kit or did you use the PCR product directly?

seanspotatobusiness on Fri Sep 5 01:44:47 2014 said:

 

hercolanium on Thu Sep 4 20:10:31 2014 said:

A professor from another university suggested that my PCR product yield is low so they advised me to increase my DNA input in lieu of nuclease-free water. I made that amount to try and lower my material consumption until I reach an acceptable result.

 

What Phage was saying was that you should add more water and buffer, so keep the 8 ul DNA and add 36 ul water, 1 ul enzyme, 5 ul buffer.

 

Do you use a PCR clean-up kit or did you use the PCR product directly?

 

 

I use the PCR product directly, also, I have tried the (8 ul DNA and add 36 ul water, 1 ul enzyme, 5 ul buffer) and no band appeared in 2% gel electriphoresis...A phage?! Hehehehe

phage434 on Thu Sep 4 20:13:37 2014 said:

No images were in your posting. I don't understand. Either you have a correct length band in your PCR, or you don't. If you do, the problem is somewhere else. If you don't, then the problem has nothing to do with restriction digests, but with PCR. Which is it?

 

This image is of my PCR product and it's the right size but there is an extra band that seems to be a primer dimer but after restriction the DNA disappears