sequences in 1001genomes - (Oct/25/2013 )

I am new here and sorry if my question is very stupid but I dont know how to deal with the sequence data from http://www.1001genomes.org/

Normally we have a sequence like this

AAAATTCAGGAACACAAAAAGACTAATCTTTTTGCTAAGAACAAGAAGAAATTAGCTTCT
CTCAATGTGATTTGATATTGAGAGTCAATTATGGTAGTGATGAAACAAATACCCGTAAAC
TCTTCGTCACTCTCTCTCTCTATACGAAGTGGTCGGAGAAGTTCAACGGAGAAGACGACA
GCAGAAAACCACGACAAAGATTGTGGGACGAAAACGCAAGAACGACGACGTTTCAGCTAG

And from http://www.1001genomes.org/ they look strange' with some columns if I open them in excel ( I dont know how to attacht a picture here :-((

What should I do to get the sequence in only ATCG order?

I want to look for sequences from some accessions.

Thank you very much

Sounds like you need what is known as a FASTA file (max line length 60 characters, no spaces usually). No idea if 1000 genomes provides them.

yes, thats what I need but they dont provide :-(

Just paste it as new sequence in BioEdit and save as fasta