Repeated mutagensis primer in site-directed mutagenesis - (Oct/07/2013 )

Hi guys,

Im trying to create point mutation in domain of gene of interest using enzynomics EZ-MIX kit. I believe this kit follow quick-change site directed mutagenesis method; PCR amplification of forward-reserve complemantary primer with the introduction of mutation in the middle of primer, follow by dpn1 digestion.

I am able to get the colonies after transformation but when i sent two clones for sequencing, sequencing result turn out there is repeated region of whole mutagenesis primer in both clones. May i know if anyone had experience this and how to overcome this problem. Im thikning sending more clones for sequencing may help.Thanks!!

I should mentioned that im able to get the point mutation, but the whole primer region duplicated. thanks!!

Do you mean that you have two duplicates of your mutation in your gene? I am having trouble understanding what you mean.

I think he's saying he has the sequence that is complementary to the mutagenesis primers duplicated in his result. Probably including the mutation he wanted.

I can imagine only two ways how this would happen, the sequence near the mutation site is highly similar and primers bind to them to, but this would be incompatible with the polymareration process. The other is the new strands somehow disaligned at nicked sites probably because the ends are complementary and duplicated the sequence during the plasmid repair in the bacterial cells.

Definitelly try more clones. But if you could post at least primer sequences, it would be possible to tell whether primers are the problem.

Thank you for the reply. Attached is the primers i used for the site-directed mutagenesis. Red color triple codon is the point mutation that i introduced instead of its original TAC triplet codon. I design the primer by myself and the primer isnt purified as may required in site-directed mutagenesis.

5’- AAACAAATTTGTTGATTGGGTTCTT

3’- AAGAACCCAATCAACAAATTTGTTT

This whole 25bp primer are duplicated or triplicated in the colonies sequences after transformation. For eg, instead of flanking-AAACAAATTTGTTGATTGGGTTCTT-flanking, now it become flanking-AAACAAATTTGTTGATTGGGTTCTTAAACAAATTTGTTGATTGGGTTCTT-flanking. i had screen more clones but couldnt found normal clones. Im not sure if its due to primer annealing since whole region instead of partial region are duplicated.

I will appreciate if anyone could give me suggestions. Thank you

That is weird that you get perfect insertion of the primer multiple times.  One can see binding of the two primers when you run them through a dimer prediction program, but it doesn't match up with what you are seeing:

Thermo Scientific, Self-Dimers:

1 dimer for: primer
             5-aaacaaatttgttgattgggttctt->
              ||||||||||||
<-ttcttgggttagttgtttaaacaaa-5

1 dimer for: Primer
5-aagaacccaatcaacaaatttgttt->
              ||||||||||||
           <-tttgtttaaacaactaacccaagaa-5
 

Are the 5' and 3' regions of your insertion site similar that would allow multiple insertions?

Does the mutagenesis kit say that a 25bp primer is sufficient for a 2bp mutation? My protocols usually required >40bp for correct mutation.

Your results are weird to say the least.  Could you provide some sequence info on your 3' and 5' gene sequence?

Was there ever any resolution to this issue? Any new thoughts? I just performed a site-directed mutagenesis and I am experiencing the same phenomenon - repetition of a sequence containing the mutant. 

I don't think there was any resolution - but it looks to me like there could possibly be some complementation of the OP's primers that could potentially lead to duplication of the site of interest.

I have observed this on multiple occasions. I have never figured out a solution, other than screening more colonies. When this happened, it was usually 1 out 5 colonies that I had sent for sequencing. I use much higher concentration of primer than what is recommended. I use roughly 4-5uM primer in the reaction which is much higher compared to my normal PCR. If I had to guess why this occurs, I think the high concentration of primer can cause this strange result.