scrambeled miR sequence - (Aug/25/2013 )

hello every body

1- I have got this sequence and I want to verify if it is a good scrambeled miR. what should I do?

2- are there databases to search for microrna targets based on sequence NOT miRID?

tnx

-mahrak-

you can do a blast search using the scrambled sequence and choose RefSeq as database and "Optimize for Somewhat similar sequences (blastn)" as program.

-pcrman-

tnx PCRman. I was wondering if you coudl take look at the results. I used https://www.genscript.com/ssl-bin/app/scramble to scramble my miR. are there other sources to get the job done?

all the best

-mahrak-

sry here are the results: file:///C:/Users/mahsa/Desktop/scrambeled%20miR.htm

-mahrak-

you did not upload your results. the site doesn't allow you to upload html file, you can just post the sequence of the scrambled miRNA here.

-pcrman-

oops. sry for that. here are my two candidates for scrambled microrna:

1- GAATAACTAGATCGTCCTAAT

2- GATCGAACCTAGACTAGTGGT

dose Ambion provide online services for scrambled microrna design? are there other sites of sort i could consult?

all the best

-mahrak-