Good evening!
I am searching for a way to analyse sequence-reads that contain blocks of sequence from 2 (or more) different genomic regions i.e.:
GATCGATGACTGTACGTGACAGCTAGTAAATAGTACCC
Genomic Region 1
Genomic Region 2
Any amount of the genome could theoretically reside between the two regions that were ligated to create this fragment.
Does anybody know of any software/program which will identify from where in the genome each block originated or have any suggestions on how I could accomplish this?
Many thanks for any help!
- TJC
-TJCooper-
If it is one of the commonly studied organisms you could try UCSC's BLAT tool. BLAST might work, but would probably need more sequence than you have provided.
-bob1-
