Protocol Online logo
Top : New Forum Archives (2009-): : Molecular Cloning

*** Human Insulin promoter sequence*** - (Sep/05/2012 )

Hi,

I would really appreciate some help. I have been looking for Human Insulin promoter sequence in NCBI nucleotide, gene for the past 24 hours with no definitive answer. I am a bit puzzled why I have found it so diffcult..must be doing something wrong... I want to PCR amplify and clone in the Human Insulin Promoter onto my Lentivirus construct therefore require the Human Insulin promoter sequence?

Thanks
Labrock

-Labrock-

Here you are. The sequence in < > is the first exon.

cacacggaagatgaggtccgagtggcctgctgaggacttgctgcttgtccccaggtccccaggtcatgccctccttctgccaccctggggagctgagggcctcagctggggctgctgtcctaaggcagggtgggaactaggcagccagcagggaggggacccctccctcactcccactctcccacccccaccaccttggcccatccatggcggcatcttgggccatccgggactggggacaggggtcctggggacaggggtgtggggacaggggtcctggggacaggggtctggggacaggggtcctggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtcctggggacaggggtctggggacaggggtctgaggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtccgggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtgtggggacaggggtcctggggacaggggtgtggggataggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacagcagcgcaaagagccccgccctgcagcctccagctctcctggtctaatgtggaaagtggcccaggtgagggctttgctctcctggagacatttgcccccagctgtgagcagggacaggtctggccaccgggcccctggttaagactctaatgacccgctggtcctgaggaagaggtgctgacgaccaaggagatcttcccacagacccagcaccagggaaatggtccggaaattgcagcctcagcccccagccatctgccgacccccccaccccaggccctaatgggccaggcggcaggggttgagaggtaggggagatgggctctgagactataaagccagcgggggcccagcagccctc

-pcrman-

pcrman on Wed Sep 5 17:26:12 2012 said:


Here you are. The sequence in < > is the first exon.

cacacggaagatgaggtccgagtggcctgctgaggacttgctgcttgtccccaggtccccaggtcatgccctccttctgccaccctggggagctgagggcctcagctggggctgctgtcctaaggcagggtgggaactaggcagccagcagggaggggacccctccctcactcccactctcccacccccaccaccttggcccatccatggcggcatcttgggccatccgggactggggacaggggtcctggggacaggggtgtggggacaggggtcctggggacaggggtctggggacaggggtcctggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtcctggggacaggggtctggggacaggggtctgaggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtccgggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtgtggggacaggggtcctggggacaggggtgtggggataggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacagcagcgcaaagagccccgccctgcagcctccagctctcctggtctaatgtggaaagtggcccaggtgagggctttgctctcctggagacatttgcccccagctgtgagcagggacaggtctggccaccgggcccctggttaagactctaatgacccgctggtcctgaggaagaggtgctgacgaccaaggagatcttcccacagacccagcaccagggaaatggtccggaaattgcagcctcagcccccagccatctgccgacccccccaccccaggccctaatgggccaggcggcaggggttgagaggtaggggagatgggctctgagactataaagccagcgggggcccagcagccctc



Thank you very much. Could you please tell me where/how you found it..accession number? Really appreciate your help. Thank you

-Labrock-