Deep sequencing adaptor question - (Apr/11/2011 )

Hello, I will be going through a deep sequencing protocol soon and it lists a series of adapters to use. The 3' adapter has the sequence 5′ AppTCGTATGCCGTCTTCTGCTTGidT 3′ and is called a 3' adenylated adapter. What does the App stand for? What is the GidT at the 3' end? That doesn't look like an adenine to me.

Thank you

To add to my question, why does the 3' linker need to be adenylated? I am using T4 RNA ligase to add this linker to my RNA fragments.

Thank you