siRNA sequence can be used as shRNA? - Stable down regulation of target gene expression. (Aug/20/2010 )
Hi Folks,
I am very new to siRNA and shRNA. I want to generate the lentivirus coding shRNA for down regulating the DYNLT1 expression.
Here is the DNA sequence of the DYNLT1:
ATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAACATT
GTAAAAGAGGCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCAAAGTGAAC
CAGTGGACCACAAATGTAGTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCA
TTTAAATACATCGTGACCTGTGTAATTATGCAGAAGAATGGAGCTGGATTACACACAGCA
AGTTCCTGCTTCTGGGACAGCTCTACTGACGGGAGCTGCACTGTGCGATGGGAGAATAAG
ACCATGTACTGCATCGTCAGTGCCTTCGGACTCTCTATTTGA
The bold and underlined part is siRNA CCACAAAUGUAGUAGAACA used by PMID: 20690922. They have shown that siRNA can down regulate the DYNLT1 expression in siRNA transfected cells.
My question is can I use the same sequence as sense sequence and create shRNA oligo?
CCACAAATGTAGTAGAACATTCAAGAGATGTTCTACTACATTTGTGG
Italics and bold indicates hairpin.
Can above construct be able to downregulate the DYNLT1 expressing?
Thanks a lot for your time and suggestions.
Niraj
The successful rate of si/sh-RNA conversion is not 100%.
U6 promoter prefers G as start and H1 promoter prefers A or G (C or T should be fine).  Your siRNA sequence starts from C, so you might want to use H1 promoter.