siRNA sequence can be used as shRNA? - Stable down regulation of target gene expression. (Aug/20/2010 )

Hi Folks,

I am very new to siRNA and shRNA. I want to generate the lentivirus coding shRNA for down regulating the DYNLT1 expression.

Here is the DNA sequence of the DYNLT1:

ATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAACATT
GTAAAAGAGGCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCAAAGTGAAC
CAGTGGACCACAAATGTAGTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCA
TTTAAATACATCGTGACCTGTGTAATTATGCAGAAGAATGGAGCTGGATTACACACAGCA
AGTTCCTGCTTCTGGGACAGCTCTACTGACGGGAGCTGCACTGTGCGATGGGAGAATAAG
ACCATGTACTGCATCGTCAGTGCCTTCGGACTCTCTATTTGA

The bold and underlined part is siRNA CCACAAAUGUAGUAGAACA used by PMID: 20690922. They have shown that siRNA can down regulate the DYNLT1 expression in siRNA transfected cells.

My question is can I use the same sequence as sense sequence and create shRNA oligo?

CCACAAATGTAGTAGAACATTCAAGAGATGTTCTACTACATTTGTGG

Italics and bold indicates hairpin.

Can above construct be able to downregulate the DYNLT1 expressing?

Thanks a lot for your time and suggestions.
Niraj

The successful rate of si/sh-RNA conversion is not 100%.
U6 promoter prefers G as start and H1 promoter prefers A or G (C or T should be fine). Your siRNA sequence starts from C, so you might want to use H1 promoter.