blunt end ligation problem - Self ligation and truncate (Jul/16/2010 )
Sometimes I face problems when I did blunt end self-ligation.
I phosphorylated the primers and followed by PCR. I did the blunt end self ligation using T4 DNA ligase. After ligation I got colonies. I purified the plasmid and sent them for sequencing. The results shows that there is a truncate at the ligation point. It did not end to end ligate while it ligate with 3 nucleotide truncated.
Like this:
(for example)
correct one should be:
AAAAAAAATTTTTTTTTCCCCCGGGG|CCCCCCCCCAATTTTTTT
TTTTTTTTTAAAAAAAAGGGGGCCCC|GGGGGGGGAATTTTTTT
But I got like this:
AAAAAAAATTTTTTTTTCCCCCG|CCCCCCCCCAATTTTTTT
TTTTTTTTTAAAAAAAAGGGGGC|GGGGGGGGAATTTTTTT
there are three nucleotide truncated.
Any suggestions why it can happened?
![]()
Hi,
If i am not wrong you did overlap extension PCR ? If it is then its common problem repeat once again and get your product sequenced before cloning.
Otherwise check the Purity of your DNA ligase and its buffer.
With Regards,
Mole .