Huge difference in Tm of my For and Rev primers = no PCR product?!? - (Feb/25/2010 )
Hello everybody,
I need to do gateway cloning but I currently have some problems amplifying the cDNA of my gene. I suspect that my primers might be the reason but I´m not sure! The problem seems to be that the forward primer starting at the ATG has a Tm of about 55°C (I varied primer lenghts but all have similar Tm´s) whereas the reverse primer at the stop codon always ends up with a Tm at around 73°C (+/- 4°C).
I already tried different taqs, templates etc. without success. Does anybody have a suggestion/idea how to solve the problem?
Thanks for help and all the best
Maybe I should mention - I used the Tm calculator from finnzymes because we´re using the Phusion taq for cloning!
What are you using for your annealing temp? You should be using something below your lowest Tm.
to test the optimal annealing temp of the primers I was running gradient pcrs starting from 54° up to 70°C!!! This was not a single pcr but different pcrs with a temp range of 10°C. And no product at any of the tested annealing temp. BTW, the gene is well expressed in wt and primer design is correct (looked it up a few times to exclude my own stupidity!)
Just a question- do your primers have an att site as part of them? If so, you should only be using the part of your primer that actually binds your template to calculate your Tm.
Can you post your PCR conditions in full?
Have you been able to use Phusion successfully for other PCRs?
hi leelee,
they don´t have an att site because we are using the TA cloning. In parallel I was/am cloning 3 other genes that worked without any problem using the Phusion protocol.
For my particular "problem" gene (2,2kb!) I was running 2 seperate protocols - 1 with a non-proof-reading taq to check if the primer works but I also tried once with the Phusion. For all my clonings, including the ones mentioned above that worked, buffer, dNTPs, template DNA etc. were the same. So these things can be excluded as cause of disaster.
1. regular taq (1kb/min)
95° - 3min
95° - 30sec
55°-65° gradient - 30sec
72° - 2min 20sec
x36
72° - 10min
2. Phusion (1kb/~30sec)
98° - 30sec
98° - 10sec
58° - 30sec (phusion says annealing = 3° + lowest Tm of primer which was 55°)
72° - 1min 10sec
36x
72° - 10min
But as I mentioned above - it worked for three other inserts, two of them were ~4kb. Therefore I don´t really understand why it doesn´t work for this "small" gene.
Thanks for help and all the best
My first step would probably be to increase the extension time- I know you said you have had previous success with 4kb frags with this protocol but it can't hurt to give it a try.
Secondly, I would run a gradient PCR with Phusion also. When I'm having PCR issues I tend to figure out my annealing temp empirically rather than relying on formulas.
I realise I am stating the obvious, but I think it is good to go back to basics when you are having probs.
Good luck ![]()
Can you post the primers and beginning and end of the sequence you want to amplify? I would try annealing temperatures down to 50C. Usually annealing has to be significantly lower than the Tm of the primers. PCR almost always fails for me with annealing below 50C, however.
Hi,
thanks for the tips.
@ leelee
I was running gradients with the GoTaq to check whether the primers work. I didn´t want to use the Phusion to test primers because it´s expensive and if it doesn´t work with the GoTaq I will not work with Phusion either. The extension time is already longer than needed - theoretically I should be able to amplify around 2500bp. 2:20 worked very well for a different cloning with a fragment of 2000bp! But maybe you´re right and I should give it a try to test 3min!
@phage434: 50°C - really!? I thought that was much too low. I have never done a PCR with less than 55°C but there is always a first time!
I will give it a try!
So here are the primers and seq - the problem is actually the reverse primer because whatever lenght I tried, the Tm was never less than 69°C (IMPORTANT - according to the Finnzymes Tm calculator....other Tm calculators give different results!)
For Primer
ATGCCTTCCTTATCCACC
For Seq (first 50bp of CDS)
ATGCCTTCCTTATCCACCCCGCCGTCCCAAAATCTCGCCTTCTCCCCTGC
Rev Primer
GGCTTGAAGCCTCAGGCG
Rev Seq (last 50bp of CDS without Stop codon)
CACCTGAATATCACTTTGTGATGTTCTTCAACCGCCTGAGGCTTCAAGCC
Thanks a lot and all the best
I would change the forward primer to
ATGCCTTCCTTATCCACCcc
and try again. This will match Tm's pretty closely. The cccc at the 3' end is not ideal, but it will priobably work.
I have no idea how you came up with a 73 C Tm for the reverse primer, but it shows at 59 for me.
The Tm depends on the calculation method. Using the Finnzymes calculator (which is relevant to me because I´m using the Phusion for the cloning) the Tm is 69°C. The 73°C was a primer I used in my very first attempt to clone the gene. But other calculation methods will give different results.
I will try the forward primer with the two more cc and post the result when I am done ![]()
thanks a lot and have a nice day