Forward and reverse primers got very different Tm - what to do? (Dec/28/2009 )

Pages: 1 2 Next

I'm trying to amplify a gene but I have problem with designing primer for the c-terminal of it.

the gene has a low GC content near the stop codon and that is why it is making this huge gap between the Tm of the two primers.

the gene reads as:

1 atggactcat ccagggcaat cgggctgtac tttgattctg cccttccctc cagcagccta
61 ttagcatttc cgatcgtcct acaagacaca ggagatggga agaagcaaat caccccacaa
121 tacaggatcc agcgtcttga ctcgtggaca gacagtaaag aggattcggt attcatcacc
181 acctatggat tcatcttcca agttgggaat gaggaagtca ctgtcggcat gattaatgat
241 aatcccgggc acgagttact ttcctctgca atgctttgcc taggaagtgt cccgaacgac
301 ggtgatcttg ttgagctggc gagggcctgc ctcactatgg tggtaacttg caagaagagt
361 gcaactaaca ctgagagaat agtcttctcg gtagtgcagg cgccccgagt gctgcaaagc
421 tgtatggtcg tggccaatag gtactcatca gtgaatgcag tgaaccatgt gaaagcacca
481 gagaagatcc ctgggagcgg aaccctagag tataaggtga actttgtctc tttgactgtg
541 gtgccgagga aggatgtcta caggatccca accgcagctt tgaaaagtat ctggctcaag
601 cctgtacaat cttgcgctca atgtcactat gattgtggag gtggacccga agagcccgtt
661 agtcaaatcc ctttccaagt cgatagttgg atactatgca attcttttct tgcatatcgg
721 ggtatggtcc actgtagaaa ggaagggaaa gaaagtgaca ttgaccaagc tagaggggaa
781 gataaggaga ctcaatctat ctgtcgggct caggattgtg ctcggacctt ccgtgcttgt
841 gaaggcgaga ggtgcacgga caaggctgtt ggcacctttc ttctcagcca gtgggacagc
901 ctgctatcct atagcaaatg cctctcccca ggtggtaaga tactctggag tcaaactgca
961 cacctgcgga gtgtaaaaat tgtcattcaa gcaggcaccc aacgtgctgt cgcagtgacc
1021 gctgatcatg aggttacctc taccaagata gagaagaggc ataccattgc taaatacaac
1081 cctttcaaaa aatag

Forward: ATG GAC TCA TCC AGG GCA LENGTH: 18 GC CONTENT: 55.6 % MELT TEMP: 56.0 ºC

Reverse: TTT TTT GAA AGG GTT GTA LENGTH: 18 GC CONTENT: 27.8 % MELT TEMP: 43.9 ºC

what to do?

-Curtis-

Make the second primer longer, TTT TTT GAA AGG GTT GTA TTT AGC

-phage434-

phage434 on Dec 28 2009, 04:15 AM said:

Make the second primer longer, TTT TTT GAA AGG GTT GTA TTT AGC

ok, thank you, as I thought. I tried not to add the gene's last TAG stop codon because I'm going to clone it to a EGFP plasmid's open reading frame. I wonder if this is still considered a complete gene or not ! I can't have the ending stop codon if I want to tag the gene. I hope my boss accepts it.

-Curtis-

Primers are cheap - try it with those two primers using 43deg as your annealing temp. Maybe you'll get lucky and only get one band or get only a couple well-separated bands.

Curtis on Dec 28 2009, 02:08 AM said:

-microgirl-

Curtis on Dec 28 2009, 06:53 PM said:

Well, then is it not possible to make it longer from the other end?

-tea-test-

Given your sequence, I would do something like:

WARNING: Right primer is unacceptable: Long poly-X OLIGO start len tm gc% any 3' seq LEFT PRIMER 1 20 61.66 50.00 5.00 2.00 atggactcatccagggcaat RIGHT PRIMER 1092 25 60.25 28.00 5.00 2.00 ttttttgaaagggttgtatttagca SEQUENCE SIZE: 1095 INCLUDED REGION SIZE: 1095 PRODUCT SIZE: 1092, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 1.00

The string of A's at the end of your sequence is a bit of a pain, but these should work OK despite the warning thrown...

-HomeBrew-

thank you guys,

I put the right primer at idtdna.com's calculator but it is giving me a very different Tm !

http://eu.idtdna.com/analyzer/applications...er/default.aspx

ttttttgaaagggttgtatttagca
MELT TEMP: 52.0 ºC

How come?

-Curtis-

Because the calculations are empirical and not very good. I pay little attention to the Tm calculations, and I think you should also. Design primers 18-24 bp long, depending on the gc content. Use an annealing temperature of 55 C, and things will usually work. Try to make the 3' base a c or g. Avoid long runs of the same base. Avoid self priming and primer-dimers with 5' overhangs and exact matches at the 3' end. Programs such as Primer3 work well if you have real problems.

-phage434-

The primers I suggested were selected by Primer3 (version 1.1.4). I agree with phage434 -- there are many ways to calculate the Tm of primers, and all produce different results. We have used Primer3 to select thousands of primers, usually shooting for a calculated Tm of around 60C, and using them in PCR with an annealing temp of between 56C and 58C. We have very few problems following these methods.

-HomeBrew-

guys,

I received the primers and I ran PCR with them. I also used controls for the target gene.

The thing is that I get a big smear above my band of 1kB.

the controls seem to be ok.

I tried reducing cDNA template, the number of cycles, elongation time etc. to reduce the smear, but it is still there after 1 week running PCR everyday.

I wanted to do PCR product purification but I decided to run all the products on gel and just cut the 1kB band.

Do you think this product would be suitable for cloning?

-Curtis-

Pages: 1 2 Next