sequencing primer: T7 or T7promoter? - (Nov/04/2009 )
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!
-kristian-
kristian on Nov 5 2009, 11:36 AM said:
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!
Thanks!
The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice
-Quasimondo-
I would choose T7 promoter as well.
-jiajia1987-
Quasimondo on Nov 5 2009, 02:25 PM said:
kristian on Nov 5 2009, 11:36 AM said:
I am going to send my recombinant plasmid to a sequencing facility. I used pGEM Teasy vector which contains a T7 promoter. The form that I am filling up gives 2 options for T7 as sequencing primer namely T7 (AATACGACTCACTATAG) and T7 Promoter (TAATACGACTCACTATAGGG). These primers target the same site in the plasmid but vary a bit in length. Please help me choose which should I use.
Thanks!
Thanks!
The longer the complementary sequence, the lower the chance you got the contaminated result, I think. So the longer sequence would be my choice
Thanks for your help!

-kristian-
jiajia1987 on Nov 5 2009, 02:50 PM said:
I would choose T7 promoter as well.
Thanks!

-kristian-