Sequencing - identifying backbone and deciphering insert information - (Sep/07/2009 )

Hi,
I am sequencing a few plasmids and I have no vector information about them. They are probably pcDNA/pFLAG CMV (but I do not know which one's in specific pFLAG cmv 1/2/3). I checked the 5' and 3' end (to my insert) of my sequences and matched it up with the plasmids but could not locate them. Can you suggest a way?
Also at times, the sequence does not match the cDNA (an aberrant bp once in a while) which leads to incorrect amino acid incorporation. At that time I go back to my chromatogram and check if that is really aberrant or just an artifact of computer reading of the sequence. I often find it is an artifact. Is that common, and is this the right way to go?

Thanks for all the help.

It is common for the computer program used to decode DNA sequence chromatograms to get the occasional base wrong, especially at the begining and end of the sequence when things get messy. It's important to check the sequence manually.
Not to sure how to find out what your vector is. Have you tried Blast? http://blast.ncbi.nlm.nih.gov/

Thanks for the reply. I have tried blast. The challenge I encounter is that, let us say, my cDNA sequence starts after 30 base pairs from the point where the computer reads correctly (before this it was all NNNNNNNNNNNN). Now using those 30 correctly read base pairs, blast does not give me the vector sequence. Does Blast actually even have the plasmid vector sequences? Thanks for help!

Try VecScreen.

A related question: The DNA stock I used was a HA-protein in the lab left behind by some seniors. I transformed it and then maxipreped it. Now I see two minor mutations in the protein. Should I ask to repeat the sequencing, is a mistake in sequencing common (the peaks in the chromatogram clearly clearly shows the nucleotide mutation though). Should I pick up another colony and maxi-prep from that? My understanding is that theoritically all the colonies should have exactly the same DNA sequence (as it was made from a DNA stock). Please help.

Hi HomeBrew, Thanks a lot for VecScreen. That helps a lot.
GTGGGAGGNCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTGATCTACCATGGACTACAAAGACGATGACGACA
AG

this is sequence befor ethe 5' end of my gene (it is FLAG tagged) as sequenced. This is a pFLAG CMV-2. I matched it manually. When I Vec Screen it, it says PCMV6-XL4. Can you help. It should ALSO suggest pFLAG CMV 2, right?

If pFLAG CMV 2 was deposited in GenBank....

Thanks Home Brew, but how would I know if pFLAG CMV 2 was deposited in Gene Bank>

Sorry -- I should have said "if pFLAG CMV 2 was deposited in VecScreen". The list of vectors included is here. The list is not comprehensive, there are many vectors not included -- it is meant to be a screen for vector contamination, not for identification of a vector. As such, they've probably eliminated a lot of redundant sequences.

If you've already manually lined up your sequence with that of pFLAG CMV-2, what other information do you need?

If you have the sequence of pFLAG CMV-2 (I assume you do), you can compare it directly to your generated sequence using the bl2seq method.