Negative control for MSP - (Nov/07/2004 )
I used methprimer to get my MSP primer for DAPK. The unmethylation primer set works well, but the methylation primer set is very weird. The negative control always shows a ladder from the first try, only 2 or 3 times i can get clean negative control. Whenever there is a ladder in the negative control, the product is almost 5-10 bases larger than the one that I expected, but right size band showed when the negative control is clean. I think i didn't contaminate the reagents. Is there any possibility that the primer sets already degrated?
It may not be related to primer degradation. What is your negative control, unconverted DNA or water? If you use unconverted DNA, you should also use water as control to exclude contamination. 
There are two possibilities:
1) contamination
2) nonspecific pairing. How many non-CpG Cs are in the M primer? Try raising the annealing temperature a bit.
I use water as negative control.
If water is used for negative control, there is no doubt that contamination is the culpit.
Thank you so much, pcrman. But i still have a question on it, here is my primer set:
 
5'GGGATTCGGTAATTCGTAGC3'
5'AAACTAACCGAAACGACGAC3'
do you think my ladder caused by amplicon  prime itself in some way  to generate concatanated products which will accumulate in number and size as the PCR cycles and form ladders? I checked my primer, and found there are several internal repeats, which would allow the PCR product to act as a primer on itself.
