Flag sequence - yeah I know, stupid question :D (Feb/04/2008 )
So here I come,
I want to have the DNA sequence of the Flag_tag. I have the aminoacid sequence but was looking for the DNA.
Now I know with the aminoacid I can find the Dna, but I know some "codon" are more represented than others... so I wanted to know if anyone has it. 
If not then yes, I'll just choose the proper DNA sequence.
Thanks all.
-SMH-
I imagine you could google it in the sequence of any pFLAG expression vector... Should definitely be OK.
-lilly78-
gactacaaggatgacgatgacaaa
this is how we have it in one of our vectors ...
-dpo-
QUOTE (dpo @ Feb 4 2008, 02:54 PM) 
gactacaaggatgacgatgacaaa
this is how we have it in one of our vectors ...
this is how we have it in one of our vectors ...
thanks.
-SMH-
