Bisulfite sequencing condition - (Nov/11/2007 )
After i got the PCR product which is a single band signal, i have done sequencing from direct PCR production. However, tha result of sequening is not good, many background signal and unclear signal. Also, the reverse primer cannot get any result but only some wrong signal.
The following is my primer information and sequecing condition.
Forward primer:GGGGTTAGAGGTTAAGGTTAGTG
Reverse primer:ATCACCTCCACCACCTAAAAAA
Product size: 173
After PCR, QIAquick PCR purification is used to purify the PCR product.
Sequencing Reaction:
Reagent:
Seq. buffer 1.75 ul
Forward primer 1ul or Reverse primer 1ul
3.1 BD 1.5ul
dd H2O 2.75ul
DNA 3ul
Condition:
96 'C 1 minute
96 'C 10 seconds
50 'C 5 seconds (25 cycles)
60 'C 4 minutes
4 'C hold
What is the problem in my method? And what is the condition in designing primer?
Thanks for help!
We don't do sequencing reactions ourselves so could not troubleshoot the sequencing reaction part. One thing you have to bear in mind is that if your samples don't have any methylation, the sequencing results tend to be dirty with background noise probably due to the unconsumed cytosine in the reaction. If sequencing service is available in your area just have your samples sequenced by them. Sequencing after TA cloning is also an option.
THX! PCRman, do SP6 and T7 tagged primer help the condition in sequencing?
Two things:
(1) your reverse primer has a poly A region at the 3' end. This is bad for sequencing reactions for two reasons. First, the poly A region tends to slip. Second, the poly A has a low melting temperature and tends to fail to extend.
(2) You should purify your PCR product with a gel. Even if you think there is a single band, short primer-dimers can dominate the reaction on a molar basis, and be invisible on the gel. They will completely trash your sequencing results unless they are eliminated.